Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... ELISA assays (see Materials and Methods for more information). Decreased Vgf content In CSF and serum precedes onset of ALS-type muscle weakness assessed by rotarod-assays. In our laboratory ... laboratory setting, G9 3A mutant SOD-1ALS mice develop muscle weakness by ~90 days of age (Figure 2A) . The severity of motor im-pairment progresses to paralysis by ~130 days of age, followed by sacrifice.[1]...
- 8
- 499
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... evalu-ated by the chi-square test for categorical variables.Comparison of group differences for continuous variables wascarried out by one-way analysis of variance or the Kruskal-Wal-lis ... 51:189-197.27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-dation of a behavioral pain scale in critically ill, sedated, andmechanically ventilated patients. Anesth Analg 2005,101:1470-1476.28. ... approximately 550 patients annually withan average age of 40 years. Surgery patients, coronarypatients, neonates and burn patients are treated in specializedunits. The study protocol was approved...
- 10
- 597
- 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... Science, Technology and Medicine, London SW7 2AZ, UK;2Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, JapanSugar conjugation is a major pathway for the inactivationand excretion ... haemocytes) was isolated by theguanidinium thiocyanate method [17]. Integument samplesmay have contained small amounts of muscle and trachealtissue also. Bmugt1 expression was s tudied by RT-PCRusing ... wasanalysed by metabolic labelling of i nfected insect cells atdifferent times after infection. Proteins were separated by SDS/PAGE and revealed by autoradiography (Fig. 3). Asexpected for a bacu...
- 7
- 470
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...
- 8
- 485
- 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... such asbundles and cables, is crucial to stabilize the organiza-tion of transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C)Quantitation analysis for GST–hhLIM association with F-actin at different concentrations ... Shijiazhuang, ChinaThe actin cytoskeleton is a highly organized anddynamic structure present in all eukaryotic cells, whereit plays a central role in many processes includingintracellular transport...
- 11
- 347
- 0
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx
... 5'-ACCAGAGGCATAC AGGGACAA-3'IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3'IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3'IL-17 ... Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S, Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, Kishimoto T, Suda T:Soluble interleukin-6 receptor triggers osteoclast formation by ... vivo are not yet clear.Rheumatoid arthritis (RA) is a complicated and treatment-refractory autoimmune disease that is characterized by a CIA: collagen-induced arthritis; CII: type II collagen;...
- 11
- 375
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras-buricase, according to the various clinical states, the type of malignancy and drugs ... for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine may enter in a sal-vage pathway, using hypoxanthine-guanine ... because each metabolic derangement is associ-ated with remarkable clinical manifestations. Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypo-calcemia...
- 11
- 715
- 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... Durante C, Cocchi M, Cossarizza A: Subject classificationobtained by cluster analysis and principal component analysis appliedto flow cytometric data. Cytometry A 2007, 71:334-344.31. Casazza ... compartment syndrome. Circ J 2006, 70:1362-1364.18. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H,Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T,Imaizumi ... sets, data was loaded into a relationaldatabase (MySQL) and analyzed with SQL statementsand graphing utilities.Melanoma Vaccine StudyAverage CV Suggests Stable CD27, CD28, and CD45RAExpression...
- 15
- 476
- 0
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
... obtain the DOA and delay values in a 2D space. By using an L-shaped ultrasonic sensor array as shownin Figure 4, TSaT-MUSIC can be extended to a 3Dlocalization algorithm.We can estimate two angles, ... angles, θ a and θb,andonetimedelay τc by using two sensor arrays Aa and Ab, and thesensor Sc, respectively. The pairs of θ a and τc,andθband τccan be decided by TSaT-MUSIC. As shown ... theirDOA and propagatio n delay values are described as (θ1,θ2, , θL)and(τ1, τ2, , τL)asshowninFigure2 .By applying T-MUSIC again at sensor B in the same sensorarray, propagation delays...
- 8
- 432
- 0
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... BS, and sk is the symbol transmitted by the kth user. The additive noise ω is assumed to bewhite circular Gaussian with var iance N0/2foreachrealand imaginary component. Under the hypothesis ... the Average AME for the sixmethods which are compared. As it was already pointedout previously, OMA achieves always the maximum possibleAME. We can notice from Figure 2(b) that SIC and TS yieldthe ... of Calgary International Conferenceon Combinatorial Structures and Applications, pp. 69–87,Calgar y, Canada, 1970.[15] T. Cover and J. Thomas, Elements of Information Theory,JohnWiley &...
- 10
- 385
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ