0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Conditional probabilities of identity of genes at a locus linked to a marker" potx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... Affinity and kinetics of proprotein convertase subtilisin kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells Seyed A. Mousavi1, Knut E. Berge1, Trond Berg2 and Trond ... low-density lipoprotein receptor; LPDS, lipoprotein- depleted serum; PCSK9, proprotein convertase subtilisin kexin type 9; PCSK9-WT, wild -type proprotein convertase subtilisin kexin type 9; TC, ... characteristics of binding of PCSK9 to LDLR. Using PCSK9 iodinated by the tyraminecellobiose (TC) method ([125I]TC-PCSK9), we measured the affinity and kinetics of binding of PCSK9 to LDLR on HepG2 cells...
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... of the 50’s loop in the Clostridium beijerinckii flavodoxin:evaluation of additivity and the importance of interac-tions provided by the main chain in the modulation of the oxidation-reduction ... activity of Fld derives from its FMN cofac-tor. The Fld semiquinone is exceptionally stable and itsmidpoint potentials are quite negative. This is a directconsequence of the differing stability ... AnFNR isoalloxazine N5 via S80[58,62]. In addition, in both enzymes, this residue iscritical for proper binding of the nicotinamide to theactive centre, CTC stabilization and efficient flavinreduction...
  • 17
  • 634
  • 0
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

... Analysis of the fungicidal effect of viscotoxin A3FEBS Journal 273 (2006) 7283 ê 2005 The Authors Journal compilation ê 2005 FEBS 79 Antifungal effects and mechanism of action of viscotoxin ... different types of cell, including animal, bacterial and fungal. The aim of this study was toobtain information on the cell targets and the mechanism of action of vis-cotoxin isoform A3(VtA3). ... biological roles and mechanisms of action. Plant Mol Biol 26, 2537.3 Giudici M, Pascual R, de la Canal L, Pfuăller K, PfuăllerU & Villalan J (2003) Interaction of viscotoxins A3 and B with...
  • 12
  • 530
  • 0
Tài liệu Báo cáo khoa học: Interactions between M proteins of Streptococcus pyogenes and glycosaminoglycans promote bacterial adhesion to host cells pdf

Tài liệu Báo cáo khoa học: Interactions between M proteins of Streptococcus pyogenes and glycosaminoglycans promote bacterial adhesion to host cells pdf

... M2 2, M3 7, M4 3, M5 6, M5 8, M5 9,AP72, AP73, AP74, AP76, AP77, AP79‡ 15% M1 , M2 , M4 , M5 , M6 , M9 , M1 2, M1 3, M1 5, M1 7, M1 8, M1 9, M2 3, M2 4, M2 5, M2 6, M2 7, M2 8, M2 9, M3 0, M3 1, M3 4, M3 6, M3 8, M3 9, M4 0, ... proteins bind glycosaminoglycans (Eur. J. Biochem. 270) 2305 Interactions between M proteins of Streptococcus pyogenes and glycosaminoglycans promote bacterial adhesion to host cells Inga-Maria Frick1, ... M4 0, M4 1, M4 6, M4 7, M4 8, M4 9, M5 1, M5 3, M5 4, M5 5, M5 7, M6 0, M6 2, M6 3, M6 6, M6 9, M7 1aMeasured at a bacterial concentration of 2 Ã 109bacteriaặmL)1;bstrains denoted AP72 AP79 are M protein-negative...
  • 9
  • 512
  • 0
Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot

Báo cáo khoa học: PRDM1/Blimp1 downregulates expression of germinal center genes LMO2 and HGAL pot

... overexpression suppresses endogenous LMO2 and HGAL expression Gene expression profiling previously performed by us[2] reveals that expression of HGAL and LMO2 isPRDM1 repression of LMO2 and HGAL ... lymphoma celllines downregulates endogenous mRNA and protein expression of both HGAL and LMO2. PRDM1 binds the HGAL and LMO2 promotersin vivoThe effect of PRDM1 on HGAL and LMO2 expres-sion ... the loss of HGAL and LMO2 expression upon differentiation of GC B cells to plasmacells and may contribute, in addition to other currentlyunknown factors, to the absence of HGAL and LMO2 expression...
  • 11
  • 343
  • 0
Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

Báo cáo khoa học: Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus doc

... conserved and unique components of the Cag- T4SS, together withpotential implications for the current understanding of its mode of action. The cagPAI and the Cag type IV secretion apparatus Gene ... 2011 The Author Journal compilation ê 2011 FEBS MINIREVIEW Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus Wolfgang FischerMax von Pettenkofer-Institut, ... components, see the accom-panying review by Cendron and Zanotti [27]. The putative type IV secretion apparatus corecomplex The assembly of different type IV secretion machines and functions of their...
  • 10
  • 393
  • 0
Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

Báo cáo khóa học: Selective release and function of one of the two FMN groups in the cytoplasmic NAD + -reducing [NiFe]-hydrogenase from Ralstonia eutropha pptx

... averages of three measurements.Ó FEBS 2004 Two FMN groups in NAD + -reducing [NiFe]-hydrogenase (Eur. J. Biochem. 271) 805 Selective release and function of one of the two FMN groups in the cytoplasmic ... demonstrate that the release or re-binding of flavin at the FMN- a binding site occurs only in reduced enzyme and that FMN- a is essential for the NADH-induced activation of the Ni-Fe site in the SH, as well ... contain FMN- a.Integrity of the SH during the release of FMN- aOur experiments show that both the extent of the drop in activity as well as the amount of released FMN weredependent on the enzyme...
  • 8
  • 371
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Simple semi-supervised training of part-of-speech taggers" pptx

... Proceedings of the ACL 2010 Conference Short Papers, pages 205–208,Uppsala, Sweden, 11-16 July 2010.c2010 Association for Computational LinguisticsSimple semi-supervised training of part -of- speech ... improve theaccuracy of a state -of- the-art POS tagger, namelySVMTool. Four semi-supervised learning meth-ods were tested, incl. self -training, tri -training, co-forests and tri -training with disagreement. ... supervised baseline. Spoustovaet al. (2009) use a new pool of unlabeled datatagged by an ensemble of state -of- the-art taggersin every training step of an averaged perceptronPOS tagger with 4–5% error...
  • 4
  • 269
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Examining the Content Load of Part of Speech Blocks for Information Retrieval" pptx

... hypothesise that the class membership of the parts of speech within such blocks reflects the content load of the blocks, on the basis that open class parts of speech are more content- bearing than ... Association for Computational LinguisticsExamining the Content Load of Part of Speech Blocks for Information RetrievalChristina LiomaDepartment of Computing ScienceUniversity of Glasgow17 ... been‘counted’, if the Content Load is zero or more,we consider the POS block content- rich. If the Figure 1: The Content Load algorithmfunction CONTENT- LOAD( POSblock)returns ContentLoadINITIALISE -FOR- EACH-POSBLOCK(query)for...
  • 8
  • 447
  • 0
Báo cáo khoa học: Tumor suppressor p16INK4a ) modulator of glycomic profile and galectin-1 expression to increase susceptibility to carbohydrate-dependent induction of anoikis in pancreatic carcinoma cells ppt

Báo cáo khoa học: Tumor suppressor p16INK4a ) modulator of glycomic profile and galectin-1 expression to increase susceptibility to carbohydrate-dependent induction of anoikis in pancreatic carcinoma cells ppt

... down-regulation of ABCFig. 6. Role of galectin-1 in p16INK4a-mediated anoikis induction. Quantification of p16INK4a and galectin-1 presence in wild-type(wt), p16INK4a-positive (p1 6) and p16INK4a⁄ ... of p16INK4aFEBS Journal 274 (200 7) 32333256 ê 2007 The Authors Journal compilation ê 2007 FEBS 3245 Tumor suppressor p16INK4a ) modulator of glycomic profile and galectin-1 expression to increase ... suppressor p16INK4arestores susceptibility to anoikis induction in human Capan-1 pancreatic carcinoma cells by increas-ing a5b1-integrin expression and surface presentationoffers such a...
  • 24
  • 395
  • 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... venoms of Vipera aspis aspis (V. a. aspis) , Vipera aspis zinnikeri (V. a. zinnikeri) , Vipera berus berus (V. b. berus) and a neurotoxic V. a. aspis snake (neurotoxic V. a. aspis) from a population ... codon, and a TATA-like box (CATAAAA) 270 bpupstream from the ATG translation initiation codon, asfound in other Viperinae and Crotalinae genes [2,22].Table 3. Structural organization of V. a. ... CGCGGATCCAATCTTGATGGGGCAGCCGGAGAGGPLA5G1 (F) AGGAYTCTCTGGATAGTGGPLA3G1 (R) CTCACCACAGACGATWTCCPLA5G2 (F) CGGTAAGCCCATAACGCCCAPLA3G2 (R) CAGGCCAGGATTTGCAGCCPLA3G4 (R) CATAAACAYGAGCCAGTTGCCARTF a (F) GAGTGGATGCACAGTCGTTGARTR a (R)...
  • 10
  • 451
  • 0
Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx

Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx

... measured the primary effect of modulating the expression of glnB in terms of the concentration of PII*, which corresponds to the sum concentration of GlnB and GlnK. The absence of variation in the deadenylylation ... arepregrown in the absence of ammonia; and nor does the sum of GlnK and GlnB. Therefore, the conclusion of a lack of (ultra)sensitivity in the cascade is notcompromised by the fact that the antibody ... with the puzzle of a func-tional explanation for the existence of GlnB: whyshould control by PII* be absent altogether, and whatthen is the function of the cascade and of its pivot GlnB? The...
  • 17
  • 390
  • 0
Báo cáo khoa học: Genome-wide identification of glucosinolate synthesis genes in Brassica rapa potx

Báo cáo khoa học: Genome-wide identification of glucosinolate synthesis genes in Brassica rapa potx

... expression of Arabidopsis glucosinolate synthesis genes altered the glucosinolate profile in Chinese cabbage [50,51]. Because most of theArabidopsis genes encoding glucosinolate biosynthesispathways ... cancerinvasion and migration by indole-3-carbinol: associatedwith up-regulation of BRCA1 and E-cadherin ⁄ catenincomplexes. J Mol Med 78, 155–165. Glucosinolate biosynthesis genes in Brassica rapa ... phylogenetic tree of flavin-containing monooxygenase family genes. Y X. Zang et al. Glucosinolate biosynthesis genes in Brassica rapa FEBS Journal 276 (2009) 35593574 ê 2009 National Academy of Agricultural...
  • 16
  • 367
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Molecular characterization and genogrouping of VP1 of aquatic birnavirus GC1 isolated from rockfish Sebastes schlegeli in Korea" potx

... sequence of genome segment B encoding the VP1 protein was determined for the aquatic birnavirus GC1 isolated from the rockfish Sebastes schlegeli in Korea. The VP1 protein of GC1 contains a 2,538 ... amino acid sequences. The marine aquatic birnaviruses (MABVs) containing GC1 were included in the MABV genogroup; the IPNV strains isolated from Korea, Japan, and the USA were included in ... aquatic birnaviruses containing GC1 and IPNV have genogroups that are distinct from those in the genus Avibirnaviruses and Entomo-birnaviruses. The birnavirusstrains were clustered into 5 genogroups...
  • 6
  • 155
  • 0
báo cáo khoa học:

báo cáo khoa học: "Conditional probabilities of identity of genes at a locus linked to a marker" potx

... that allow : (1)computation of probabilities of identity of genes at a marker locus, conditional on theobservation of phenotypes among relatives, and (2) derivation of ... significance of effects attached to the identity states of genes linked to the marker locus. In the case of a population of half sibs from an heterozygousfather, the statistical ... Conditional probabilities of identity of genes at a marker locus We consider a diploid population and a marker locus. We assume that the systemis autosomal, regular and thoroughly...
  • 13
  • 173
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ