báo cáo khoa học: "Experimental comparison of methods for si

báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx

... traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test J.L. CAMPO Carmen RODRIGUEZ Departamento de Genetica Cuantitativa ... Mejora Animal, Instituto Nacional de Investigaciones Agrarias, Carretera de La Coruna Km 7, 28 040 Madrid, Spain Summary Index selection (I) was compared with...

Ngày tải lên : 09/08/2014, 22:22

9
249
0

Báo cáo khoa học: Modiﬁed PCR methods for 3¢ end ampliﬁcation from serial analysis of gene expression (SAGE) tags doc

... (20 09) 26 57 26 68 ª 20 09 The Authors Journal compilation ª 20 09 FEBS mRNA mRNA NBAAAAAAA-3′ NBAAAAAAA-3′ NBAAAAAAA Modified oligo (dT) NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT 16 16 16 16 16 16 16 16 5′ 5′ 5′-cap ... primer: 5¢-(biotin)ATTGGCGCGCCGCGAGCACTGAGTCAATACGA(T) 30 VN-3¢ rSAGER 1: 5¢-GCGAGCACTGAGTCAATACGA-3¢ rSAGEF 1: 5¢-A...

Ngày tải lên : 07/03/2014, 00:20

12
544
0

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... 6- phosphate and 40 mm glucose 6-phosphate; 30% KOH was added to the control of each assay. Reactions were incubated for 30 min at 25 and 4 °C, and then at 10 min at 95 °C. Anthrone 0 .2% in 95% H 2 SO 4 was ... Ichimura K, Imada S & Yamaki S (20 01) Sucrose synthase and sucrose phosphate synthase, but not acid invertase, are regulated by cold acclimation and deacclimat...

Ngày tải lên : 14/02/2014, 22:20

13
707
0

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

... interfaces within neuronal nAChR subunit combinations (compare Fig. 2A C) 4 .Sofar ,a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI) interfaces have ... presumably a3 b2b4* and a6 /a3 b2b4* nAChRs in canine intracardiac ganglia, rat medial habenula neurons and in locus coerulus neurons [75,76,79] (F...

Ngày tải lên : 19/02/2014, 12:20

15
757
0

Tài liệu Báo cáo khoa học: "Phrase-Based Backoff Models for Machine Translation of Highly Inﬂected Languages" docx

... usu- ally works well in cases where the domain is ﬁxed, the training and test data match, and a large amount of training data is available. Nevertheless, standard SMT models tend to perform much ... Building and Us- ing Parallel Texts: Data-Driven Machine Transla- tion and Beyond, pages 91–94, Ann Arbor, Michi- gan. D. Gildea. 20 01. Statistical Language Understanding Using Fra...

Ngày tải lên : 22/02/2014, 02:20

8
379
0

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... simple and non-recursive base Noun Phrase (baseNP) is an important subtask for many natural language processing applications, such as partial parsing, information retrieval and machine translation. ... parameter training In this work, the training and testing data were derived from the 25 sections of Penn Treebank. We divided the whole Penn Treebank data into two sections, one...

Ngày tải lên : 08/03/2014, 05:20

8
482
0

Báo cáo khoa học: "Coding the Russian Alphabet for the Purpose of Mechanical Translation" pptx

... effect a much greater reduction in the total number of stems, as well as making for a more elegant and satisfactory morpho- 3 For an alternative approach, see A. G. Oettinger, Automatic Language ... “soft sign”, whereas the nominative and accusative singular of feminine nouns, the imperative singular, the second person of the present indicative and the infinitive...

Ngày tải lên : 23/03/2014, 13:20

4
260
0

Báo cáo khoa học: "Knowledge-Based Weak Supervision for Information Extraction of Overlapping Relations" ppt

... Craven and Kumlien (1999) introduced the idea by matching the Yeast Protein Database (YPD) to the abstracts of papers in PubMed and training a naive-Bayes extractor. Bellare and Mc- Callum (20 07) ... Christopher Manning. 20 05. Incorporating non-local information into information extraction systems by gibbs sam- pling. In Proceedings of the 43rd Annual Meeting of the Ass...

Ngày tải lên : 30/03/2014, 21:20

10
336
0

Báo cáo hóa học: " Research Article Accurate Methods for Signal Processing of Distorted Waveforms in Power Systems" potx

... November 20 04. [10] A. Bracale, P. Caramia, and G. Carpinelli, “Optimal evalua- tion of waveform distortion indices with Prony and rootmusic methods, ” to appear in International Journal of Power and ... analytical comparison of AEM and APM computational eﬀorts cannot be stated with general validity, since AEM and APM use diﬀerent models to approximate the waveforms. B...

Ngày tải lên : 22/06/2014, 23:20

14
328
0

báo cáo khoa học: "Ultrasound-guided thrombin injection for the treatment of an iatrogenic hepatic artery pseudoaneurysm: a case report" ppt

... 6(5 ):7 93-798. 10. Yamakado K, Nakatsuka A, Tanaka N, Takano K, Matsumura K, Takeda K: Transcatheter arterial embolization of ruptured pseudoaneurysms with coils and n-butyl cyanoacrylate. J Vasc Intervent Radiol ... nodosa, necrotizing vasculitis, acute pancrea- titis and hepatocellular carcinoma [2] . Most HAPs occur extrahepatically, predominantly in the right hepatic artery [...

Ngày tải lên : 10/08/2014, 23:20

4
309
1

báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium 2 Index selection and independent culling levels : a replicated single generation test" potx