Báo cáo y học: "Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcript" ppt
Báo cáo y học: "Targeted next-generation sequencing of a cancer transcriptome enhances detection of sequence variants and novel fusion transcript" ppt
... selection. MFB and JZL analyzed the sequence data. XA and AG confirmed fusion transcripts and SNPs, respectively. JZL, CN, LAG, and AG conceived and directed the research.Additional data filesThe ... alignment parameters and coverage levels.Validation of sequence alterations Novel SNPs called by RNA-Seq were validated by traditionalbidirectional Sanger sequencing of PCR products that hadbeen ... study, we demonstrated that combining hybridizationcapture of a cDNA library with Illumina sequencing provides a robust and sensitive method to detect a wide range of DNA and RNA sequence alterations...
- 8
- 295
- 0
Báo cáo y học: "Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis" pps
... coronary angiography for any indication and had no history of a coronary revascularization procedure prior to the scheduled angiography. Forty-four patients had a history of myocardial infarction ... 260 and economic evaluation, of myocardial perfusion scintigraphy for the diagnosis and management of angina and myocardial infarction. Health Technol Assess. 2004; 8: 1-207. 34. Elhendy A, Bax ... computer-based, mathematically derived analysis of resting two-lead ECG data provides detection of hemodynamically relevant CAD with high sensitivity and specificity that appears to be at least as...
- 15
- 456
- 0
Báo cáo y học: " Computerized two-lead resting ECG analysis for the detection of coronary artery stenosis after coronary revascularization" doc
... data provides detection of hemodynamically relevant CAD in patients with a history of coronary revascularization with high sensitivity and specificity that appears to be at least as good as ... of relevant restenosis, de-novo stenosis, and graft stenosis as diagnosed with coronary angiography in patients after coronary revascularization that is at least as good as that of standard ... Harris RA, et al. The role of coronary angiography and coronary revascularization before noncardiac vascular surgery. JAMA. 1995; 273: 1919-1925. 8. Scanlon PJ, Faxon DP, Audet AM, et al. ACC/AHA...
- 12
- 418
- 0
Báo cáo y học: "Monoclonal Antibodies against Nucleophosmin Mutants: Potentials for the Detection of Acute Myeloid Leukemia" ppt
... Hematology, University of Perugia, Perugia, Italy). The forward and backward primers were: 5’-CGGGATCCATCGAAGGTCGTGAAGATTCGATGGACAT-3’, and 5’-CGCGCGACCGAGCGGAA GCTTCTATTTTCTTAAAGAGAC-3’. Underlined ... was dialysed against phosphate-buffered saline (PBS) overnight at 4°C and stored at -80°C before analyzed by SDS-PAGE and quantitated by using the BCA Protein Assay Kit (Be-yotime, Shanghai, ... five years, several qualitative and quantitative molecular assays for identifying NPM1 mutations have been developed. Currently available screening of NPM1 mutations using conventional polymerase...
- 6
- 431
- 0
Báo cáo y học: "eening the human exome: a comparison of whole genome and whole transcriptome sequencing" pot
... nucleotide variants and overlap between datasetsWe used SAMtools to call SNVs in our aligned gDNA and cDNA sequences. Indels and large structural variants were not analyzed. SAMtools called 51,055 ... data for a more easily accessible tissue suchas skin for this exon array publicly available; however, onecan extrapolate that adding cDNA from almost any tissuewould be similarly beneficial ... coverage RNA-Seq in the same individual. This comparison allowed us to directly evaluate the sensitivity and specificity of RNA-Seq in identifying coding variants, and to evaluate how key parameters...
- 8
- 299
- 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... 13AD3.1ND.1AD8.2AD3.2ND.2AD8.1counts / millionATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG070140210280hsa−mir−64 2a ... inhibition of themiR-30 family, RNA was extracted and analyzed at day 10 of differentiation. (b) For over-expression of pre-miR3 0a and pre-miR-30d,RNA was extracted and analyzed at day 4 of differentiation. ... tRNA,rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA). Reads that did not match any of those non-coding RNA classes werelabeled as ‘non-annotated’. Data are the average of...
- 13
- 365
- 0
Báo cáo y học: "Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome" pdf
... remaining sitesATCAGCGGTAATGA CATAGGGATATCAGC GGTAATGA CATAGGGAAATCAGC GGTAATGA CATAGGGATATCAGC GGTAATGA CATAGGGAAGSSGSSGSS GSSSNP A- genome A- genomeB-genomeATCAGC GGTA TGA CATAGGGATAATCAGC ... phenotypicvariation that eventually can play a critical role in the origin of new adaptations and important agronomic traits.BackgroundComparative analysis of grass genomes reveals a com-plex ... cycles of PCR in a 50-μl reaction mixcontaining 0.4 μM primer -A (CAAGCAGAAGACGG-CATACGAGCTCTTCCGATCT), 0.4 μM primer-B(AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTTC CGATCT) and 25 μlPhusion...
- 17
- 479
- 0
Báo cáo y học: "Targeted genomic capture and massively parallel sequencing to identify genes for hereditary hearing loss in middle eastern families" pot
... DNA sample of a Moroccan Jewish proband, eval-uated by this approach, led to the discovery of fourmutations, two of them novel, and solved the cause of hearing loss of a n additional 20 families. ... Materials and methods.Discovery of novel mutationsIn each of the 11 probands, multiple potentially func-tional variants of predicted damaging effect were identi-fied by our approach and validated ... es of families with CDH23, MYO1 5A, TECTA,andWFS1 mutations. (a) Segregation of hearing loss with wild-type (N) an ddeafness-associated variants (V) in each family. (b) Sanger sequences of each...
- 11
- 354
- 0
Báo cáo y học: "Bench-to-bedside review: The MET syndrome – the challenges of researching and adopting medical emergency teams"
... Kause J, Smith G, Prytherch D, Parr M, Flabouris A, Hillman K:Australian and New Zealand Intensive Care Society ClinicalTrials Group. A comparison of antecedents to cardiac arrests,deaths and ... Instead, as in the case of cardiac arrest and traumateams, change in practice may be slow and progressive, even inthe absence of level I evidence. It appears likely that theaccumulation of evidence ... equipment,methods, and recognition by staff may be a major stumblingblock in improving outcomes and RRS performance. Regularstaff educational programs and audits of technology and processes of care are necessary...
- 6
- 494
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... recovery was une-ventful, and the patient was discharged on postoper-ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... of a monolayer of inner circular muscle, which makes its wall weak, as com-pared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers. The vasa ... invagination of diverticu-lum has an advantage over diverticulectomy in that it minimizes bowel leakage [15]. Moreover, invagina-tion of diverticulum can be easily performed using laparoscopy...
- 3
- 531
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam