0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

Báo cáo Y học: Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant doc

Báo cáo Y học: Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant doc

... Structural basis for the inhibitory efficacy of efavirenz (DMP-266), MSC194 and PNU142721 towards the HIV-1 RT K103N mutant Jimmy Lindberg1, Snævar Sigurðsson1, ... the binding modes of the three inhibitors aresuperimposed in the mutant NNIBP. The cyclopropyl-group of MSC194 and the methyl group of PNU142721 partly overlap the trifluoromethyl group of Efavirenz. Furthermore, ... structural analysis of the binding mode of the inhibitors in complexwith wild-type RT and the K103N mutant should giveinsight i nto the structural basis f or the inhibitory efficacy and the resistance...
  • 8
  • 566
  • 0
Báo cáo y học:

Báo cáo y học: "Gene expression profiles in the rat streptococcal cell wall-induced arthritis model identified using microarray analysis" docx

... the time course study in the streptococcal cell wall (SCW)-induced arthritis in Lewis (LEW/N) ratHeat map diagram of differential gene expression in joints from the time course study in the streptococcal ... calculated by divid-ing the mean intensity signal from all the individual SCW-injected rats included in each group by the mean intensitysignal from the corresponding PBS control group. The levelof ... search analysisTemporal gene expression profiles in the reactivation model of streptococcal cell wall (SCW)-induced arthritis in rat identified using Spotfiređ profile search analysis. The seven...
  • 17
  • 487
  • 0
Báo cáo y học:

Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

... 9, Article R90Research mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancerChao ChengÔ*, ... biogenesis pathway may beRE-score profiles of microRNAs for the classification of ER+ and ER- breast tumorsFigure 6RE-score profiles of microRNAs for the classification of ER+ and ER- breast ... especially Ago2 and Dicer, were differentiallyexpressed between ER- and ER+ breast cancer, which may explain the different regulatory effects of microRNAs in these two breast cancer subtypes.Conclusions:...
  • 17
  • 259
  • 0
Báo cáo y học:

Báo cáo y học: "Gene expression profiles in BCL11B-siRNA treated malignant T cells" ppt

... recentidentification of activating Notch1 mutations in themajori ty of patients with T- ALL has bro ught interests ontargeting the Notch signaling pathway for this disease [5].The B-cell chronic lymphocytic leukemia ... activationby interacting with the p300 co-activator at theupstream site 1 (US1) of the interleukin (IL)-2 promo-ter, leading to transcriptional activation of IL-2 expres-sion in activated T cells ... inhibiting the anti-apop-totic function. Thus, we analyzed the BCL-2 protein expression level by flow cytometry in Molt-4 cells at 72hafterBCL11B-siRNA treatment (Figure 1F). A similaraltered expression...
  • 6
  • 328
  • 0
Báo cáo y học:

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

... identity and 66-70% aminoacid identity was found between the < /b> NS1 proteins. The< /b> NS allele A is more common and is the < /b> only subtypefound in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ ,resulting a product of 550 bp; and b- actin forward5’ TGGGTCAGAAGGACTCCTATG 3’ and reverse5’ AGAAGAGCTATGAGCTGCCTG ... [29-34]. The < /b> N-terminal RNA binding domain binds to < /b> both sin-gle- and double-stranded RNA that might inhibit the< /b> activation and/ or signalling of antiviral proteins, such asRIG-I, PKR, OAS/RNase L, activators...
  • 8
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: " T4 genes in the marine ecosystem: studies of the T4-like cyanophages and their role in marine ecology" doc

... hyroxymethyl cytosine or that they glycosylate their DNA. In addition all of the r genes in T4 that areknown to be in volve d in superinfection and lysis inhibi-tion [45] are missing in cyanophage ... 7:291http://www.virologyj.com/content/7/1/291Page 12 of 19 REVIEW Open Access T4 genes in the marine ecosystem: studies of the T4- like cyanophages and their role in marine ecologyMartha RJ Clokie1, Andrew ... original work is properly cited. doi:10.1186/1743-422X-7-291Cite this article as: Clokie et al.: T4 genes in the marine ecosystem: studies of the T4- like cyanophages and their role in marine...
  • 19
  • 524
  • 0
Báo cáo y học:

Báo cáo y học: " Does respiratory health contribute to the effects of long-term air pollution exposure on cardiovascular mortality?" pot

... air pollution is driven by the impact of air pollution on respiratory health is unknown. The aim of this study was to investigate whether respiratory health at baseline contributes to the effects ... association did only change marginally when including indicators of respiratory health into the regression analysis. Furthermore, no interaction between air pollution and respiratory health on cardiovascular mortality ... plasmaviscosity during an air pollution episode: a link to mortality?Lancet 1997, 349:1582-1587.14. De Leon SF, Thurston GD, Ito K: Contribution of respiratory dis-ease to nonrespiratory mortality associations...
  • 11
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Neonatal immune responses to TLR2 stimulation: Influence of maternal atopy on Foxp3 and IL-10 expression" pot

... of 9(page number not for citation purposes)Respiratory ResearchOpen AccessResearchNeonatal immune responses to TLR2 stimulation: Influence of maternal atopy on Foxp3 and IL-10 expressionBianca ... effects of microbial stimulation on early immune responses and in association with maternal atopy. Methods: We analyzed immune responses of cord blood mononuclear cells (CBMC) from 50 healthyneonates ... stimulation with Ppg (data notshown).Effect of maternal atopy on markers of T cell subpopulations To determine the importance of maternal atopy on parameters of subsets of T cells in addition to IL-10, ...
  • 9
  • 313
  • 0
Báo cáo y học:

Báo cáo y học: "Thiolated chitosan nanoparticles enhance anti-inflammatory effects of intranasally delivered theophylline" pptx

... 1 of 10(page number not for citation purposes)Respiratory ResearchOpen AccessResearchThiolated chitosan nanoparticles enhance anti-inflammatory effects of intranasally delivered theophyllineDong-Won ... chitosan, theophylline or theophylline plusunmodified chitosan. Thiolated chitosan nanoparticles (TCNs) enhance anti-inflammatory effects of theophyllineThe effects of theophylline on OVA allergen-induced ... effects of theophylline were significantlyenhanced when the drug was delivered by TCNs.Conclusion: Intranasal delivery of theophylline complexed with TCNs augmented the anti-inflammatory effects...
  • 10
  • 294
  • 0
Báo cáo y học:

Báo cáo y học: " Distinct expression profiles of TGF-β1 signaling mediators in pathogenic SIVmac and non-pathogenic SIVagm infections" pot

... more increased in early SIVmac infectionthan in SIVagm infection. SIVmac itself might dysregulatethe TGF-β1 signaling cascade by interacting directly orindirectly with Smad molecules. Indeed, ... CentralPage 1 of 6(page number not for citation purposes)RetrovirologyOpen AccessShort report Distinct expression profiles of TGF-β1 signaling mediators in pathogenic SIVmac and non -pathogenic SIVagm ... during pathogenic and non -pathogenic SIV infectionsFigure 1Dynamics of pro- and anti-inflammatory markers in PBMC during pathogenic and non -pathogenic SIV infec-tions. A. Tnf-α, ifn-γ and...
  • 6
  • 215
  • 0
Báo cáo y học:

Báo cáo y học: "Mechanical ventilation during experimental sepsis increases deposition of advanced glycation end products and myocardial inflammation" pdf

... 3ResearchMechanical ventilation during experimental sepsis increases deposition of advanced glycation end products and myocardial inflammationMartin CJ Kneyber1,2,3, Roel P Gazendam1,2, Hans ... myocardium has been foundin experimental studies and in humans dying from sepsis [7-9]. Advanced glycation end products (AGE) such as Nε-(car-boxymethyl)lysine (CML) may play an important role in ... http://ccforum.com/content/13/3/R87Page 7 of 7(page number not for citation purposes)14. Schmidt AM, Yan SD, Yan SF, Stern DM: The biology of thereceptor for advanced glycation end products and its ligands.Biochim Biophys Acta...
  • 7
  • 237
  • 0
Báo cáo y học:

Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx

... indicates that DNA repair pathwaysare a key determinant of cell survival after radiation, andthat targeting the molecular components of these path-ways offers therapeutic potential [1-3].When assessing ... modifiers on radiation sensitivity assume a constant effect independent of the radiation dose received. The aim of this study was todevelop and evaluate a modelling strategy by which radiation dose ... indicator whichassumes the value zero for the control case, i.e. radiation alone, and one for the drug-treated case; and δx – where"x" is any of the parameters above – is the variation...
  • 7
  • 320
  • 0
Báo cáo y học:

Báo cáo y học: "Using protein complexes to predict phenotypic effects of gene mutatio" pps

... that of random pairs. To com-pare intersections of predictors to single predictors, theexpected frequency was the greater of the two predictorsalone. To compare intersections of predictors to ... 'phenotype pairs', that is, pairs of geneswhose loss leads to similar phenotypic profiles. If we couldidentify an effective predictor of phenotype pairs, and if thepredictor is sufficiently ... phenotypes to find what types of data are predictive of phenotypes inyeast; we then apply this framework to human diseasephenotypes.Results Protein complexes as predictors of phenotypeSeveral groups...
  • 9
  • 192
  • 0
Báo cáo y học:

Báo cáo y học: "Histone deacetylase inhibition accelerates the early events of stem cell differentiation: transcriptomic and epigenetic analysis" doc

... work is properly cited.Histone deacetylase inhibition in stem cell differentiation<p>A gene profiling study of mouse embryonic stem cells treated with the histone deacetylase inhibitor ... inhibitor trichostatin A shows that inhibition of histone deacetylases accelerates the early events of differentiation, by regulating the expression of pluripotency- and differentiation-asso-ciated ... embryonic stem cells employing transcriptomic and epigenetic analysis.Results: Embryonic stem cells treated with the histone deacetylase inhibitor Trichostatin A (TSA),undergo morphological and...
  • 15
  • 322
  • 0
Báo cáo y học:

Báo cáo y học: "Genomic context analysis in Archaea suggests previously unrecognized links between DNA replication and translation" potx

... functional interactions of proteins involved in DNA replication and/ or DNA repair or transcription might occur in Archaea, suggesting a previously unrecognized regulatory network coupling DNA replication ... encoding proteins conserved in Archaea and Eukarya is strongly supportedby statistical analysis. Interestingly, the gene encoding the S27E protein, also known asmetallopanstimulin 1 (MPS-1) in ... Biology 2008, 9:R71Open Access2008Berthonet al.Volume 9, Issue 4, Article R71ResearchGenomic context analysis in Archaea suggests previously unrecognized links between DNA replication and...
  • 16
  • 286
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM