Báo cáo sinh học: " Modelling and optimizing of sequential selection schemes: a poultry breeding application" ppt
Báo cáo sinh học: " Modelling and optimizing of sequential selection schemes: a poultry breeding application" ppt
... is obtainedforV!(!). A matrix formulation of [14] isGo and Go!i! are, respectively, the initial and asymptotic matrices of geneticvariances and covariances. As explained ... mean of performances of each hatch. Also, as shown by Andersen (1994), we have in such a situation:Thus the calculation is tantamount to the computation of the variance ... and Quaas (1988), using a Newton-Raphson algorithm. Selection of mated pairsThis type of selection occurs at t2 and t4.At t2, NdSi females (mates) remain candidates to...
- 30
- 233
- 0
Báo cáo y học: "units and outcome of critically ill children: a prospective observational study" ppt
... independently associ-ated with an increased occurrence of MODS and pro-longed PICU stay.• These novel and important observational data jus-tify undertaking a randomized controlled trial to eval-uate ... infection: a meta-analysis. J Trauma 2003, 54:908-914.11. Vamvakas EC, Blajchman MA: Universal WBC reduction: the case for and against. Transfusion 2001, 41:691-712.12. Shorr AF, Jackson WL: Transfusion ... design of the study and helped to draft the manuscript.TD performed the statistical analysis and helped to draft the manuscript. SB,AGR and JL conceived of the study and helped to draft the manuscript....
- 8
- 231
- 0
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... their support and coopera-tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage-ment and data entry assistance. We acknowledge the Zambian Ministry of Health for consistent ... oversight and imple-mentation and critical edits to the manuscript. All authorsread and approved the final manuscript.Additional materialAcknowledgementsThe authors thank our study participants...
- 10
- 501
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis. We also thank Brad Finneyfrock and Marisa St. Claire at ... ≤40°C.Evaluation of replication of viruses in AGMs and efficacy against challengeAGMs in groups of two to four animals at a time wereinoculated intranasally (i.n.) and intratracheally (i.t.)with ... trial using clinical grade virus preparations.Evaluation of the two vaccine candidates revealed thatthey are reasonable candidates for further study in clinicaltrials. Both candidates replicated...
- 13
- 504
- 0
Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx
... Vegetable Research, P B 5002, P 0-B H U, Varanasi, Uttar Pradesh, 221005, IndiaEmail: HC Prasanna* - prasanahc@yahoo.com; Mathura Rai - mathura.rai@gmail.com* Corresponding author AbstractBackground: ... JournalOpen AccessResearchDetection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast AsiaHC Prasanna* and Mathura RaiAddress: Indian Institute of Vegetable ... AF188481ToLCBDVTomato leaf curl Gujarat virus-[Kelloo] AF449999ToLCGV-[Kel]Tomato leaf curl Gujarat virus-[Vadodara] AF413671ToLCGV-[Vad]Tomato leaf curl Gujarat virus-[Varanasi] AF190290ToLCGV-[Var]Tomato...
- 10
- 567
- 0
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... genesMyrnaCBonaldo*1, Samanta M Mello1, Gisela F Trindade1, Aymara A Rangel2, Adriana S Duarte1, Prisciliana J Oliveira1, Marcos S Freire2, Claire F Kubelka3 and Ricardo Galler2Address: ... ACGAGCTGTACAAGAAGTT-GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCCAAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTAGAGAC 3'). This fragment included 24 nucleotides fromthe carboxi-terminal of the EGFP gene ... RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10 and are represented in all panels as 5P1,...
- 16
- 428
- 0
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... equally Abstract Background Coxsackievirus A1 6 (CVA16) is a member of the Enterovirus genus of the Picornaviridae family and it is a major etiological agent of hand, foot, and mouth disease ... rational development and testing of candidate live attenuated vaccines and antiviral therapeutics against CVA16. Methods Cells and viruses RD and Vero cells were grown in DMEM (Gibco, Grand...
- 22
- 455
- 0
Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot
... acceptance and implementation of ECPs. These barriers include the lack of awareness, lack of familiarity with the protocol, lack of agreement, lack of demonstrated safety and efficacy, lack of ... The mismatch between human ability and the vast amount of data and information contributes to variation in clinical practice as decisions are made applying different data constructs and different ... protocols for mechanical ventilation? The human brain has a limited ability to incorporate data and information in decision making and human memory can simultaneously retain and optimally utilize...
- 26
- 435
- 0
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
... Nakayama H, Gohda E, Arakaki N,Sakiyama O, Takahashi K, Kimoto M, Kawasaki S, Setoguchi M, Tachikawa T,Shin S, Arima T, Daikuhara Y: Levels of the human hepatocyte growthfactor in serum of ... Hashiya N, Makino H, Yamasaki K, Azuma J, Sawa Y,Matsuda H, Kaneda Y, Ogihara T: Safety evaluation of clinical genetherapy using hepatocyte growth factor to treat peripheral arterialdisease. ... Japan Farm (Kagoshima, Japan) and Charles River Laboratories Japan Inc. (Yokohama,Japan), respectively. The animals were maintained underconstant room temperature (25°C), and given free accessto...
- 12
- 567
- 0
Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx
... reponderance of clinical articles and journals in the car diac liter ature:clinical journals dominate a larger area of the cardiacmap than the cancer map. Of the 75 most active cardiacjournals, a ... importance of standardization and regulatory tools for both research and clinical care[34].Citation a nalysis also reveals evidence of ritual use of citations. It is likely that many of the ... demonstrate that systematic analysis of pub-lication and citation data from tens of thousands of articlescan capture important features of active fields of scientificresearch, in this case in...
- 12
- 528
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM