0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme II Prediction of asymptotic genetic gain in a heterogeneous population" docx

Báo cáo sinh học:

Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous population" docx

... 1-8Original articleExpected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous populationF ... paper (Phocas et al,1995).Derivation of annual genetic gain and genetic lagsThe asymptotic genetic gain in open populations is usually derived by calculatingthe year-by-year ... unimodal assumption of candidates for selection within an age classis not valid. Moreover, the probabilities of origin of each kind of breeding animals (for instance, AI and...
  • 18
  • 304
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx

... deviations of differentials for Hs are in the range of uncertainty in maternal variance of W210.Standard deviations for selection differentials in Hg are in the range of ... scheme, standard deviations increase when progeny test capacity increases. More malesare evaluated on maternal performance and thus the uncertainty in preweaningparameters has a larger ... parameters and the scheme organisation of the Limousin breed, taken as a representative example of French beef cattle breeding schemes.Three major questions are investigated...
  • 22
  • 373
  • 0
báo cáo sinh học:

báo cáo sinh học:" Designing financial-incentive programmes for return of medical service in underserved areas: seven management functions" potx

... financial incentives for return of medical service in underserved areas: a healthworker enters into a contract to practise for a number of years in an underserved area in exchange for a financialpayoff.Table ... for the long-term success of financial-incentive programmes (Figure 1). First, pro-grammes need a sustainable source of financing to pay for the financial incentives and programme administration(financing). ... intendedincrease in the rate of health worker education throughfinancial-incentive programmes because of limited educa-tion capacity may need substantial start-up financing tobuild educational institutions...
  • 14
  • 400
  • 0
báo cáo sinh học:

báo cáo sinh học:" Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives of system actors" ppt

... an important increaseTable 3: Basic health unit personnel reasons for characterizing the contracting mechanism as advantageous or disadvantageousCategory ReasonsSomewhat advantageous 1. Salary ... tothe central coordinating offices in Guadalajara. Based onproductivity reports, the coordinating office estimates theadditional payment. Statistical records are maintained atthe central level ... researchers. Informed consent for all inform-ants was obtained prior to the beginning of the interview.The selection of informants in the qualitative componentwas purposeful and intentional, aiming...
  • 11
  • 420
  • 0
báo cáo sinh học:

báo cáo sinh học:" Community-owned resource persons for malaria vector control: enabling factors and challenges in an operational programme in Dar es Salaam, United Republic of Tanzania" ppt

... Mayagaya V,Mtasiwa D, Mshinda H, Fillinger U, Lindsay SW, et al: Interdependence of domestic malaria prevention measures and mosquito-humaninteractions in urban Dar es Salaam, Tanzania. Malar ... Mtasiwa D, Kiama M, Lindsay SW, Fillinger U, Kannady K,Tanner M, Killeen GF: Community-based surveillance of malaria vectorlarval habitats: a baseline study in urban Dar es Salaam, Tanzania. ... Ifakaratent trap-B, the standardized resting boxes and the human landingcatch for sampling malaria vectors and other mosquitoes in urban Dares Salaam, Tanzania. Malar J 2009, 8:197.38. Castro...
  • 11
  • 653
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" ppt

... early stage of infectionMatthijs Raaben1, Alexandra WC Einerhand2, Lucas JA Taminiau2, Michel van Houdt2, Janneke Bouma2, Rolien H Raatgeep2, Hans A Büller2, Cornelis AM de Haan1 ... cultures. Data are presented as mean ± standard error of mean (n = 6). For statistical analysis a one-way ANOVA with the Tukey-Kramer test was performed using GraphPad Prism version 3.00 for Windows ... A, Ciucci A, Chiappa L, Castilletti C, Martella V,Decaro N, Buonavoglia C, Capobianchi MR, Santoro MG:Indomethacin has a potent antiviral activity against SARScoronavirus. Antivir Ther 2006,...
  • 5
  • 449
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Fixed point-type results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type" potx

... Investigacion y Desarrollo de Procesos, Universidad del Pais Vasco, Campus of Leioa (Bizkaia) – Aptdo. 644-Bilbao, 48080-Bilbao, Spain 2Department of Mathematics, Texas A& amp;M University - Kingsville, ... point-type results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type Manuel De la Sen*1 and Ravi P Agarwal2 1Instituto de Investigacion ... via Lemma 2.1 as follows for the case when A and B do not intersect, in general: Theorem 3.1. Assume that BABAT∪→∪: is a modified weak φ-contraction, that is, a cyclic self-map satisfying...
  • 35
  • 325
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx

... below). For information about publishing your research in EURASIP Journal on Advances in SignalProcessing go tohttp://asp.eurasipjournals.com/authors/instructions/ For information about other SpringerOpen ... del Blanco, F Jaureguizar, N Garcia, Visual tracking of multiple interact-ing ob jects through Rao–Blackwellized data association particle filtering, in IEEE Proceedings of the International Conference ... cited.An advanced Bayesian model for the visualtracking of multiple interacting objectsCarlos R del Blanco∗, Fernando Jaureguizar and Narciso Garc´ a Escuela T´ecnica Superior de Ingenieros...
  • 38
  • 394
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot

... 150CUA CGC CUG AAU AAG UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAGCUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAGCUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU G G G3’ G GAGGGAAUCGGAUGGCUUCAUCGGGUCCAGCCUGGCGCUCCUCCACCUCUACGGUACGGCUGGG CUACUUACACACCAGUCAGCACUCCACACACCCCCCUGGGGGAGUGAGGUUCUGCUAGUCUAUUCCCGACGUUAGCGCCGUGAUCAGCGGGGGCAUAAUGGAGCAHDV- ... CUA UCU UCA CAU CUA CUC CGA GCU GGU AAU UCA CCA UGG CAG UUA ACA CAG UUU UUA GAC UGG AUA AGC CUU GGG AGG GGU UUA GCU ACA UCG GCU CUC GUU CCG ACGACG GAU CCG AGA UUU5’(1) ST3 S2 5’ untranslated...
  • 11
  • 455
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf

... Pediatrics, Jawaharlal Institute of Post-graduate Medical Education and Research, Pondicherry – 605 006, IndiaEmail: Rangaiah S Jayakeerthi* - srjkeerthi@yahoo.com; Raghava V Potula - raghava@potula.net; ... Srinivasan2 and S Badrinath1Address: 1Department of Microbiology, Jawaharlal Institute of Post-graduate Medical Education and Research, Pondicherry – 605 006, India and 2Department of Pediatrics, ... Bangalore were blind passaged in sucklingmice by intracerebral inoculation.Subsequently the strains were adapted to porcine kidneycell line in the laboratory by serial blind passage. Porcinekidney...
  • 7
  • 454
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ