Báo cáo khoa hoc:" Mixed effects linear models with t-distributions for quantitative" docx
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx
... thatincludes a DNA-binding domain, a ligand-bindingdomain and a transactivation domain. The DNA-bind-ing domain is responsible for DNA binding specificity and dimerization, and the ligand-binding ... ê 2010 FEBS MINIREVIEW Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing Khairul I. Ansari and Subhrangsu S. MandalDepartment of Chemistry and Biochemistry, ... steroid- hormone- mediated gene activation and signaling. In this minireview, wesummarize recent advances in understanding the roles of MLLs in gene regulation and hormone signaling and highlight...
- 15
- 607
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: histone H3 lysine 4 methyltransferases from yeast to human pptx
... directed towards histone H3 lysine 4 methylation and the enzymesinvolved in this covalent modification in eukaryotes ranging from yeast to human. These studies revealed a set of histone H3 lysine 4 ... CREB-binding protein; EcR,ecdysone receptor; HAT, histone acetyl transferase; H3K4, histone H3 lysine 4; HMT, histone methyltransferase; MLL, mixed lineage leukemia; MOF, male absent on the ... HoxA9[ 145 , 147 ]. Further, the MLL3 ⁄ MLL4 complex coor-dinates H3K4 methylation with demethylation of histone H3 at K27 through its UTX subunit [49 ,133,1 34, 148 , 149 ]. Furthermore, H3K4 methylationis...
- 17
- 665
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in human malignancies and potential therapy pdf
... proteins. Thus, the MEN1 ⁄ LEDGF-interactingdomain linked to DNA-binding domains (AT-hook and MT domain) becomes disconnected from the PHDdomains, the FYRN domain, the transactivatingdomain, ... compilation ê 2010 FEBS MINIREVIEW Mixed lineage leukemia: roles in human malignancies and potential therapy Rolf MarschalekBiochemistry, Chemistry & Pharmacy, Institute of Pharmaceutical ... Frankfurt ⁄ Main, Germany Mixed lineage leukemia fusions, acuteleukemia and the HOX signature Mixed lineage leukemia (MLL) rearrangements definea small subset of acute leukemia patients, includingthose...
- 10
- 657
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... 1841 of cell fate. Leukemias associated with loss -of- functionor gain -of- function variants of MLL1 are prime exam-ples of the importance of maintaining the enzymaticactivity of MLL1 under tight ... MINIREVIEW Mixed lineage leukemia: a structure–function perspective of the MLL1 protein Michael S. Cosgrove and Anamika PatelDepartment of Biology, Syracuse University, NY, USAIntroductionChromosomal ... of MLL1 can increase the binding of other important transcriptional activators that ulti-mately could result in the synergistic activation of genetranscription. In addition, cooperative transcriptionfactor...
- 11
- 761
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... fromGiardia lamblia, which contains a Trp residue at the structurally equiva-lent position, establishes the need for complementary mutations and maintenance of weak interactions in order to accommodate...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... the involvement of DNA gyrase in the antimicrobial effects of H4-(8 6–1 00) and related compounds was obtained in vitro by the mea-surement of their inhibitory activity on the supercoiling of pBR322 ... those of the inactive antimicrobial fragmentsHNb-( 1–1 3) and HNb-( 3–1 3) (Table 2) were not signifi-cant (Fig. 6B).The antimicrobial and anti -DNA gyrase potencies of HNr, H4-(8 6–1 00), compound 3 and ... inability of OGP [or H4-(8 9– 102)] to inhibit DNA gyrase was also in accordancewith its low antimicrobial activity (Fig. 6B and Table 2).Comparison of the DNA gyrase inhibitory activity of HN with...
- 12
- 756
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... presence of E2. Binding of ERa and ERbwas increased in both ERE1 and ERE2 of the HOXC13 promoter (Fig. 5A, lanes 1–4). The levels of E2-induced binding of ERa and ERb were higher in ERE2 than in ERE1. ... E2-dependent binding of any of the MLLs⁄ ERs, indicating no significant roles of these EREs in HOXC13 activation (Fig. 5A).To further confirm the E2-dependent binding of ERs and MLLs to the HOXC13 promoter, ... binding profiles in a time-dependentmanner in ERE1 and ERE2 (Fig. 5B). In agreementwith the above findings, binding of ERa and ERb wasincreased in both ERE1 and ERE2 in the presence of E2. Interestingly,...
- 12
- 518
- 0
Tài liệu Báo cáo khoa học: "Mixing Multiple Translation Models in Statistical Machine Translation" docx
... and Alfons Juan. 2007. Domain adap-tation in statistical machine translation with mixturemodelling. In Proceedings of the Second Workshopon Statistical Machine Translation, StatMT ’07, pages177–180, ... 2010.Discriminative instance weighting for domain adapta-tion in statistical machine translation. In Proceedingsof the 2010 Conference on Empirical Methods in Nat-ural Language Processing, EMNLP ... Marcello Federico. 2009. Do-main adaptation for statistical machine translation withmonolingual resources. In Proceedings of the FourthWorkshop on Statistical Machine Translation, StatMT’09, pages...
- 10
- 456
- 0
Báo cáo khoa học: "Training Phrase Translation Models with Leaving-One-Out" ppt
... have shown that training phrase models canimprove translation performance on a state-of-the-art phrase- based translation model. This isachieved by training phrase translation probabil-ities ... learn phrase translation probabilities for phrase- based statistical machine translation thatgo beyond pure counting of phrasesin word-aligned training data. Mostapproaches report problems with ... target phrase. In (Ferrer and Juan, 2009), phrase models aretrained by a semi-hidden Markov model. Theytrain a conditional “inverse” phrase model of thetarget phrase given the source phrase. ...
- 10
- 391
- 0
Báo cáo khoa học: " Extending Latent Semantic Analysis with features for dialogue act classification" pot
... of other dialogue related features, such as Game, to classifyDAs. The drawback of features such as Game is that FLSA: Extending Latent Semantic Analysis with features for dialogue act classificationRiccardo ... (Kintsch,2001). We will show that for our task, dialogue act classification, syntactic features do not help, butmost dialogue related features do. Surprisingly, one dialogue related feature that ... IllinoisChicago, IL 60607 USAbdieugen@cs.uic.eduAbstractWe discuss Feature Latent Semantic Analysis (FLSA), an extension to Latent Semantic Analysis (LSA). LSA is a statistical method that is...
- 8
- 409
- 0
Báo cáo khoa học: "Forest Reranking: Discriminative Parsing with Non-Local Features∗" docx
... Ohio, USA, June 2008.c2008 Association for Computational LinguisticsForest Reranking: Discriminative Parsing with Non-Local Features∗Liang HuangUniversity of PennsylvaniaPhiladelphia, PA ... 26).Alternatively, discriminative parsing is tractable with exact and efficient search based on dynamicprogramming (DP) if all features are restricted to belocal, that is, only looking at a local window withinthe ... Better k-best Parsing. In Proceedings of the Ninth Interna-tional Workshop on Parsing Technologies (IWPT-2005).Liang Huang and David Chiang. 2007. Forestrescoring: Fast decoding with integrated...
- 9
- 315
- 0
Báo cáo khoa học: "Beyond Log-Linear Models: Boosted Minimum Error Rate Training for N-best Re-ranking" docx
... 37–40,Columbus, Ohio, USA, June 2008.c2008 Association for Computational LinguisticsBeyond Log-Linear Models: Boosted Minimum Error Rate Training for N-best Re-rankingKevin Duh∗Dept. of Electrical ... algorithms for machinetranslation rely on log-linear models, whichhave the potential problem of underfitting the training data. We present BoostedMERT, anovel boosting algorithm that uses Minimum Error ... NIPS.F.J. Och et al. 2004. A smorgasbord of features for sta-tistical machine translation. In HLT/NAACL.F.J. Och. 2003. Minimum error rate training in statisticalmachine translation. In ACL.R....
- 4
- 239
- 0
Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx
... preferential treatment, E(Di!), increased with or2 h, as illustrated intable I. Original article Attenuating effects of preferential treatment with Student-t mixed linear models: a ... clearly inappropriate. It appears that some robust linear models can handle preferential treatment of animals better than the standard mixed effect linear model with Gaussian ... the values of Qh and A as shown in the Appendix. The averageamount of preferential treatment actually applied was assessed via a simula-tion of 1000 replicates of the...
- 19
- 302
- 0
Báo cáo khoa hoc:" Mixed effects linear models with t-distributions for quantitative" docx
... machinery of mixed effects linear models can be exploited.An appealing alternative is to fit linear models with robust distributions for the errors and for the random effects. ... AU2 /82) process with s2 wu N X2. Iv,,. The augmented joint posterior density is Original article Mixed effects linear models with t-distributions for quantitativegenetic ... 1998)Abstract - A Bayesian approach for inferences about parameters of mixed effects linear models with t-distributions is presented, with emphasis on quantitative geneticapplications....
- 18
- 207
- 0
Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx
... beneficial effects of EPO in preclinical models of shock, trauma and haemorrhage are exciting, but furtherstudies are warranted to determine the effects of EPO onoutcome (organ injury/dysfunction and ... antioxidant and anti-inflammatory effects of EPO, which have been reported in other models of disease[11]. Thus, the beneficial effects of EPO in rodent models of endotoxaemia may vary with doses of ... survival) in models of CLP. Interestingly, in 86 patients admitted to a long-termacute care facility, administration of weekly recombinanthuman EPO (n = 42) resulted in a significant reduction in exposure...
- 2
- 174
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP