Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

Báo cáo khoa hoc:" Attenuating effects of preferential treatment with Student-t mixed linear models: a simulation study" docx

... preferential treatment, E(Di!), increased with or2 h, as illustrated in table I. Original article Attenuating effects of preferential treatment with Student-t mixed linear models: a ... clearly inappropriate. It appears that some robust linear models can handle preferential treatment of animals better than the standard mixed effect...
Ngày tải lên : 09/08/2014, 18:21
  • 19
  • 302
  • 0
Báo cáo khoa học: "The effects of cyclophosphamide treatment on the pathogenesis of subgroup J avian leukosis virus (ALV-J) infection in broiler chickens with Marek''''s disease virus exposure" potx

Báo cáo khoa học: "The effects of cyclophosphamide treatment on the pathogenesis of subgroup J avian leukosis virus (ALV-J) infection in broiler chickens with Marek''''s disease virus exposure" potx

... curve analysis was done with an initial denaturation at 95 o C. DNA melting was accomplished with an initial temperature of 65 o C for 10 seconds and a gradual temperature increase with a transition rate ... were analyzed using Kruskal- Wallis analysis of variance. Significance was assumed at the 0.05 level of probability. Results Body weight, relative bursal weight and lympho...
Ngày tải lên : 07/08/2014, 17:22
  • 10
  • 485
  • 0
báo cáo khoa học: " Molecular imaging of potential bone metastasis from differentiated thyroid cancer: a case report" docx

báo cáo khoa học: " Molecular imaging of potential bone metastasis from differentiated thyroid cancer: a case report" docx

... exclude a metabolically active spinal metastasis. Case report We present the case of a 50-year-old Caucasian woman with a vertebral metastasis of a less well differentiated thyroid cancer, who was ... An MRI scan revealed a ver- tebral metastasis at the T11 level with intraspinal exten- sion compressing the spinal cord. Our patient was operated on via a bilateral posterola...
Ngày tải lên : 10/08/2014, 23:20
  • 5
  • 426
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Gene...
Ngày tải lên : 18/02/2014, 11:20
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... The inflammation is also accompanied by the release of large amounts of ATP from stimulated cells [13,25]. A large body of evidence indicates that cationic antimicrobial peptides create channels ... 253–257. 34 Takeshima K, Chikushi A, Lee KK, Yonehara S & Matsuzaki K (2003) Translocation of analogues of the antimicrobial peptides magainin and buforin across human cell membran...
Ngày tải lên : 18/02/2014, 14:20
  • 12
  • 756
  • 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... from an alternative initiation of translation with an inframe ATG located 78 bp down- stream of the first ATG. (B) Graphic representation of the results obtained in the REF assay expressed as percentage ... REF assay, subcellular localization, and transcrip- tional activity. Some of these analyses have assigned differential functions to the two isoforms, and we show that the unique a...
Ngày tải lên : 18/02/2014, 16:20
  • 11
  • 586
  • 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... S inica, Taipei, Taiwan Volvatoxin A (VVA) has been isolated from Volvari- ella volvacea, and consists of volvatoxin A2 (VVA2) and volvatoxin A1 (VVA1) [1]. VVA has several biolo- gical activities, ... of volvatoxin A2 (VVA2) to volvatoxin A1 (VVA1) was inhibited by the amphipathic a- helices of VVA1. The VVA2 and VVA1 mixture (molar ratio 2) was incubated with VVA1 beads; the...
Ngày tải lên : 19/02/2014, 06:20
  • 12
  • 585
  • 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... (5¢-TAGTTC CCCGGGGGTGAAGCTGA AGTTTCTCTGACCGGTCAGCCGTTC-3¢) and reverse primer tsf-DOWNS (5¢-AGTCA GGATCCGTCGACA GAGCTTCGCCACTCAACTTAAGCAGAA-3¢). Like primer Ts185, Ts224 contains a unique AvaI restriction site (underlined) and part of a sequence ... ensure a satisfactory frequency of homologous recombination for the gene replacement. The upstream fragment was prepared using forward...
Ngày tải lên : 21/02/2014, 00:20
  • 12
  • 502
  • 0
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

... were combined with Filtron-X scintillant (National D iagnostics, Atlanta, GA, USA) and radioactivity was measured using a beta counter (2200CA Tri-carb Liquid Scintillation Ana- lyser; Canberra Packard, ... equipped with argon, krypton, and ultraviolet lasers. Confocal images w ere acquired at ·40 magnification using TCS NT software (Leica Microsystems). Statistical analysis Statistical...
Ngày tải lên : 07/03/2014, 16:20
  • 11
  • 527
  • 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... ATGGCCAAAATCACAAGGGTTAGC ABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGG ABCC11 ... the ABC transporters for quantitative real-time RT-PCR. ABC transporter Position of primer Forward oligo sequence Reverse oligo sequence ABCB1 834–1086 GCCTGGCAGCTGGAAGACAA...
Ngày tải lên : 07/03/2014, 21:20
  • 16
  • 517
  • 0

Xem thêm

Từ khóa: