Báo cáo khoa học: " A phase III trial comparing an anionic phospholipid-based cream and aloe vera-based gel in the prevention of radiation dermatitis in pediatric patients" pdf
Tài liệu Báo cáo khoa học: "A probabilistic generative model for an intermediate constituency-dependency representation" pptx
... to the three models (BGM, BEM, WFM) specified in equations(2-4) and explained in the main text.3 A probabilistic Model for TDSThis section describes the probabilistic generative model which ... Head-Driven StatisticalModels for Natural Language Parsing. Ph.D. the-sis, University of Pennsylvania.Marie-Catherine de Marneffe and Christopher D. Man-ning. 2008. The Stanford Typed DependenciesRepresentation. ... metric, as for UAS,and BAS. Concerning the other metrics, as thenumber of k-best candidates increases, the PCFG model outperforms the TDS-reranker both accord-ing to the BDS and the JDS.Unfortunately,...
- 6
- 555
- 0
Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt
... Saarbrăucken{neumann|schmeier}@dfki.deAbstractWe present a mobile touchable application for online topic graph extraction and exploration of web content. The system has been imple-mented for operation on an iPad. The topic graph is constructed ... CP DM. It is used for constructing the topic graph in the final step. For- mally, a topic graph T G = (V, E, A) consists of aset V of nodes, a set E of edges, and a set A of nodeactions. Each ... is basi-cally a graphical structure of the topic and as-sociated topics that are found.2. The user can interactively explore this topic graph using a simple and intuitive touchable user interface...
- 6
- 458
- 0
Báo cáo khoa học: A new bright green-emitting fluorescent protein – engineered monomeric and dimeric forms pptx
... Press, New York.44 Karasawa S, Araki T, Yamamoto-Hino M & Miyawaki A (2003) A green-emitting fluorescent protein fromGalaxeidae coral and its monomeric version for use in fluorescent labeling. ... evolution of a monomeric, bright and photostable version of Clavularia cyan fluorescent pro-tein: structural characterization and applications in fluo-rescence imaging. Biochem J 400, 53 1–5 40.50 Ando ... on a gray background. (B) A scleractinian coral,Cyphastrea microphthalma, collected in1.2 m of water off Lizard Island on the Aus-tralian Great Barrier Reef. (C) Overlay of theabsorption (abs),...
- 12
- 381
- 0
Báo cáo khoa học: "A Cascaded Linear Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" pdf
... seg-mentation only and joint segmentation and part-of-speech tagging. On the Penn Chinese Treebank 5.0, we obtain an error reduction of18.5% on segmentation and 12% on joint seg-mentation and part-of-speech ... a cascaded linear model for joint Chinese word segmentation and part-of-speech tagging. With a character-basedperceptron as the core, combined with real-valued features such as language models, ... performance898 Proceedings of ACL-08: HLT, pages 897–904,Columbus, Ohio, USA, June 2008.c2008 Association for Computational LinguisticsA Cascaded Linear Model for Joint Chinese Word Segmentation...
- 8
- 445
- 0
Báo cáo khoa học: "A phase II randomized trial comparing radiotherapy with concurrent weekly cisplatin or weekly paclitaxel in patients with advanced cervical cancer" potx
... AccessA phase II randomized trial comparing radiotherapy with concurrent weekly cisplatin or weekly paclitaxel in patients with advanced cervical cancerFady B Geara1*, Ali Shamseddine2, ... as: Geara et al.: A phase II randomized trial comparing radiotherapy with concurrent weekly cisplatin or weekly paclitaxel in patients with advanced cervical cancer. Radiation Oncology 2010 5:84.Submit ... gemcitabine,tirapazamine, a nd topotecan. In a phase II randomized study by Dueñas-Gonzalez et al, patients with stage IB2-IIB disease were randomized to cisplatin or cisplatin plusgemcitabine...
- 8
- 300
- 0
Báo cáo khoa học: "A phase I radiation dose-escalation study to determine the maximal dose of radiotherapy in combination with weekly gemcitabine in patients with locally advanced pancreatic adenocarcinoma" doc
... andlate toxicity. As in our study, the acute toxicity consisted of dose- limiting GI toxicity. Application of the linear quad-ratic model indicates that 42 Gy in 2.8 Gy-fractions is bio-logically ... considerations The study intent was to determinate the DLT of escalatingdoses of RT delivered concurrently with a fixed dose of gemcitabine (300 mg/m2) administered on a weekly basiswithin the ... than radiation field sizes used in our CRT regi-men, because the RT volume is the most critical variableinfluencing GI toxicity in gemcitabine- based CRT regi-Table 2: GI toxicity: The different...
- 7
- 433
- 0
Báo cáo khoa học: " A phase III trial comparing an anionic phospholipid-based cream and aloe vera-based gel in the prevention of radiation dermatitis in pediatric patients" pdf
... JS, PB and DP conductedpatient exams and participated in data collection. TD par-ticipated in the collection of data and data analyses. CL and XX assisted in writing the manuscript. All authorsread ... after radiation therapy was initiated, the skin was usually treated daily with an aloe vera-based gel. The patients or their caregivers would apply the gel lightly and attempt to avoid any skin markings ... including phase II and III trials comparing different agents in the treatment of radi-ation dermatitis. In one Phase III trial, 194 female patientsreceiving breast or chest-wall irradiation were randomizedto...
- 8
- 562
- 0
báo cáo khoa học: " A randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)" pdf
... randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)Mary Margaret Huizinga2,3,12, Ayumi Shintani4, Stephanie Michon2, Anne Brown1,5, ... Nashville, TN, USA and 12VA National Quality Scholars Program, Nashville, TN, USAEmail: Mary Margaret Huizinga - mary.margaret.huizinga@vanderbilt.edu; Ayumi Shintani - ayumi.shintani@vanderbilt.edu; ... primary outcome is the glycemic relapse rate at 24months. Relapse is defined as a HbA1c greater than 8%and an absolute 1% increase from baseline. The HbA1cwill be measured at baseline and at...
- 9
- 361
- 0
báo cáo khoa học: " A group randomized trial of a complexity-based organizational intervention to improve risk factors for diabetes complications in primary care settings: study protocol" ppsx
... when a trained facilitator meetswith staff and clinicians in each practice over severalmonths to assist the team in addressing an issue, such asimproving risk factors for diabetes complications. ... are to: 1. Evaluate the effectiveness and sustainability of PF to improve risk factors for type 2 diabetes complications across a variety of primary care settings.Hypothesis 1a: Patients within ... among staff and clinicians; and 3) to advance the sci-ence of translational research in primary care settings byexamining the sustainability of the intervention. The spe-cific objectives are...
- 7
- 319
- 0
báo cáo khoa học: " A cluster randomized trial to improve adherence to evidence-based guidelines on diabetes and reduce clinical inertia in primary care physicians in Belgium: study protocol [NTR 1369]" potx
... purposes)Implementation ScienceOpen Access Study protocol A cluster randomized trial to improve adherence to evidence-based guidelines on diabetes and reduce clinical inertia in primary care physicians in Belgium: ... to address non -adherence to evidence-based guidelines and to reduce &apos ;clinical inertia& apos; in primary care physicians [21-23]. Clinical inertia is defined as a lack of treatment initiationor ... for diabetes and reduce clinical inertia in primary care physicians. Design: Two-arm cluster randomized controlled trial. Participants: Primary care physicians in Belgium.Interventions: Primary...
- 11
- 420
- 0
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx
... Facility [20]. A line was identified thatcontained a T-DNA insertion within the first exon of ERS1(Fig. 1A) . Sequence at the T-DNA junction with ERS1 wasATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtc-cggg), ... 5' to the site of the T-DNA insertion, and ETR1- 3'F (5'CATACCGAAAGTTCCAGCCATTC 3') and ETR1- 3'R (5'CAAGCATCCATAACTCGATCCAAATTC 3') for amplifica-tion of a ... (5'-CACAACCGCGCAAGAGACTTTAGCAATAGT-3'). The etr1- 9 mutant was identified by a PCR-based method using an ETR1- specific primer (5'-GCG-GTTGTTAAGAAATTACCCATCACACT-3') and the same...
- 15
- 393
- 0
Báo cáo y học: " A phase 1 trial of nebulised heparin in acute lung injury" ppt
... care length of stay was 12 ± 8 days and the hospital length of stay was 28± 14 days. The tracheostomy rate was 63% and the hospitalmortality was 43%.Table 1 Baseline and microbiological characteristics ... pulmonary function with inhaled heparin and other glycosaminoglycans [19 ,20,29]. Heparin has a range of anticoagulant actions and also promotes fibri-nolysis through increased t-PA levels [15 -18 ]. ... ± 10 19 ± 3 19 ± 5 Acute lung injury causePneumonia 332 210 (63)Sepsis 0 011 2 (13 )Pancreatitis 010 12 (13 )Empyema 10 102 (13 )Aspiration 00000Surgical admission 3 012 6 (38)MicrobiologyGram-negative...
- 8
- 221
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP