... Psychiatry 1971, 34, 415-426.15. Iwane M, Kitamura Y, Kaisho Y, Yoshimura K, Shintani A, Sasada R, Nakagawa S, Kawahara K, Nakahama K, Kakinuma A. Production, purification and characterization ... DNA was synthesized artificially based on the sequence of the predicted Canis familiaris nerve growth factor beta (5′-ATGTCCATGTTGTTCTACACTCTGAT CACAGCTCTTCTGATCGGCATCCGGGCAGAACCGCATCCAGAGAGCCATGTCCCAGCAGGACACGCCATCCCCCACGCCCACTGGACTAAGCTTCAGCATTCCCTT-3′; ... phCMV1 and pcDNA2 was performed using T4 DNA ligase (TaKaRa Bio, Japan). The rpdβ-NGF plasmid was transformed into Escherichia coli TOP10 cells and DNA extracted with a plasmid purification kit.Production...