0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Gene therapy with an improved doxycycline-regulated plasmid encoding a tumour necrosis factor-alpha inhibitor in experimental arthritis pot

Gene therapy with an improved doxycycline-regulated plasmid encoding a tumour necrosis factor-alpha inhibitor in experimental arthritis pot

Gene therapy with an improved doxycycline-regulated plasmid encoding a tumour necrosis factor-alpha inhibitor in experimental arthritis pot

... inhibited in an experimental model.Materials and methodsDNA and cells Plasmid DNA was propagated in DH5-α Escherichia coli andwas purified using a standard Plasmid Mega Kit (Qiagen Ltd.,Crawley, ... tumour necrosis factor-alpha inhibitor in experimental arthritis David Gould, Nasim Yousaf, Rewas Fatah, Maria Cristina Subang and Yuti ChernajovskyBone and Joint Research Unit, Barts and The London, ... activ-ity in the absence of antibiotic [12]. An improved transactiva-tor, rtTA2S-M2, was generated that has greater stability thanrtTA (reverse tetracycline transactivator) and is also respon-sive...
  • 12
  • 301
  • 0
Báo cáo y học:

Báo cáo y học: "nhibition of established collagen-induced arthritis with a tumour α necrosis factor-α inhibitor expressed from a self-contained doxycycline regulated plasmid" pptx

... illustrated in panels a and b; those with a clinical score of2 or less at the time of DNA injection (day 27) are illustrated in panelsc and d; and animals with a clinical score greater than 2 at the ... expression and increase the magnitude ofregulation, as was recently achieved with an adenoviralvector [28].According to data obtained in clinical trials, transfection ofhuman skeletal muscle with injected ... relax-ant Hypnorm™ (Janssen Animal Health, Janssen Pharma-ceuticals, Beerse, Belgium) and were anaesthetized with halothane (Concord Pharmaceuticals Ltd, Dunmow, UK)using Boyle’s apparatus...
  • 11
  • 464
  • 0
Báo cáo y học:

Báo cáo y học: "Polymorphism in the tumour necrosis factor receptor II gene is associated with circulating levels of soluble tumour necrosis factor receptors in rheumatoid arthritis" ppsx

... genotyping and ELISA work. DLMconceived and oversaw the study, carried out statisticalanalyses and interpretation of data, and finalized the manu-script. The final manuscript was read and approved ... Both are transmembrane glycopro-teins with a three domain structure: a multiple cysteine-richmotif bearing an extracellular domain that facilitates ligandbinding; a hydrophobic membrane spanning ... domain; and an intracellular domain that mediates signal transduction. Thereceptor molecules share significant homology in their extra-cellular domains but they have distinct intracellular...
  • 8
  • 390
  • 0
Báo cáo y học:

Báo cáo y học: "Circulating tumour necrosis factor-α bioactivity in rheumatoid arthritis patients treated with infliximab: link to clinical respone" pot

... ELISA kits (Biosource,Camarillo, CA, USA), in accordance with the manufac-turer's instructions.Statistical analysisStatistical analysis was performed using the Statview soft-ware (Abacus ... Birbara CA, Teoh LA, Fischkoff SA, Chartash EK: Adalimu-mab, a fully human anti-tumor necrosis factor alpha mono-clonal antibody, for the treatment of rheumatoid arthritis in patients taking concomitant ... (RA) patients treated with infliximabPatterns of plasma tumour necrosis factor (TNF)-α bioactivity in rheu-matoid arthritis (RA) patients treated with infliximab. Using this bioassay three patterns...
  • 7
  • 453
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

... transferase-mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartateaminotransferase; BUN: blood urea nitrogen; Cr: Creatinine.AcknowledgementsThis work was supported by grants ... therapy using viral vectors is an attracti vealternative approach to cancer therapy, with the potentialto give therapeutic ratios superior to standard chemo-and radiotherapy [10]. The horseradish ... obtained from Shang-hai SLAC Laboratory Animal Co. Ltd (Shanghai, China)were housed in specific pathogen-free condition at theAnimal Experimental Center of Wuhan University. Thefacilities and...
  • 10
  • 696
  • 0
báo cáo hóa học:

báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

... of infection; ELISA: enzyme-linkedimmunosorbant assay; TUNEL: terminal deoxynecleotidyl transferase-mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartateaminotransferase; ... liver andkidney and the histological examination of hematoxylinand eosin stained major organs (Figure 5). Taking allthese data into consideration, it appears t hat combina-tion therapy of AdhTERTHRP/IAA ... markers including alanine transami-nase (ALT), aspartate aminotransferase (AST), b loodurea nitrogen (BUN) and creatine (Cr) using commercialkits (Sigma, MO, USA). For histological examination,some...
  • 10
  • 485
  • 0
báo cáo hóa học:

báo cáo hóa học:" Increased androgen receptor expression in serous carcinoma of the ovary is associated with an improved survival" doc

... less than1 cm where possible. Volume of residual disease was notavailabe. Standard adjuvant therapy was combination ofpaclitaxel and platinum-based chemotherapy.Median age at diagnosis was 62 ... homeostasis and androgen receptor (AR) activity have been implicated in ovarian carcinogenesis but the relationship between AR expression in ovarian cancer and clinical outcome remains unclear.Methods: ... 1).Nodin et al. Journal of Ovarian Research 2010, 3:14http://www.ovarianresearch.com/content/3/1/14Page 6 of 6evaluaton and drafted the manuscript. All authors read and approved the finalmanuscript.AcknowledgementsThis...
  • 6
  • 367
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "In vitro and in vivo gene therapy with CMV vector-mediated presumed dog b-nerve growth factor in pyridoxine-induced neuropathy dogs" pot

... Psychiatry 1971, 34, 415-426.15. Iwane M, Kitamura Y, Kaisho Y, Yoshimura K, Shintani A, Sasada R, Nakagawa S, Kawahara K, Nakahama K, Kakinuma A. Production, purification and characterization ... DNA was synthesized artificially based on the sequence of the predicted Canis familiaris nerve growth factor beta (5′-ATGTCCATGTTGTTCTACACTCTGAT CACAGCTCTTCTGATCGGCATCCGGGCAGAACCGCATCCAGAGAGCCATGTCCCAGCAGGACACGCCATCCCCCACGCCCACTGGACTAAGCTTCAGCATTCCCTT-3′; ... phCMV1 and pcDNA2 was performed using T4 DNA ligase (TaKaRa Bio, Japan). The rpdβ-NGF plasmid was transformed into Escherichia coli TOP10 cells and DNA extracted with a plasmid purification kit.Production...
  • 7
  • 276
  • 0
Báo cáo khoa học: The fabp4 gene of zebrafish (Danio rerio) ) genomic homology with the mammalian FABP4 and divergence from the zebrafish fabp3 in developmental expression pot

Báo cáo khoa học: The fabp4 gene of zebrafish (Danio rerio) ) genomic homology with the mammalian FABP4 and divergence from the zebrafish fabp3 in developmental expression pot

... analysisPhylogenetic analysis of zebrafish fabp4 and fabp3 andother fish and mammalian FABP genes was performedusing clustalx [43]. The Antarctic fish H6-FABP and H8-FABP sequences were included in this analysis, ... Phylogenetic analysis clustered the zebrafishFABP4 with all Antarctic fish H6-FABPs and putative FABP4s from otherfishes in a single clade, and then with the mammalian FABP4s in an exten-ded clade. ... pan-creas and one cranial ganglion (posterior lateral lineTable 1. Conserved syntenies of the zebrafish fabp4 with human FABP4. –, data not available. Gene nameZebrafish a Humanb Gene symbolLinkage...
  • 13
  • 478
  • 0
AN IMPROVED METHOD OF CONSTRUCTING A DATABASE OF MONTHLY CLIMATE OBSERVATIONS AND ASSOCIATED HIGH-RESOLUTION GRIDS docx

AN IMPROVED METHOD OF CONSTRUCTING A DATABASE OF MONTHLY CLIMATE OBSERVATIONS AND ASSOCIATED HIGH-RESOLUTION GRIDS docx

... codes, so additional information was used:location, name and country. Each additional station was compared with the stations already in the database,both to avoid unnecessary duplication and to ... (2005)CLIMATE DATABASE CONSTRUCTION 711they are widespread. This method also has none of the advantages of a manual method; an automated methodis essential to handle such large quantities of data. ... remaining area is ‘relaxed’ to the normal. The percentage is approximate because the remaining area may include some genuineestimates of zero anomalies. The six climate variables represented in...
  • 20
  • 443
  • 0

Xem thêm

Từ khóa: monitoring duchenne muscular dystrophy gene therapy with epitope specific monoclonal antibodies2015 combination therapy with oleanolic acid and metformin as a synergistic treatment for diabetes j diabetes res 2015 pp 1 12partnering with safety net primary care clinics a model to enhance screening in low income populations—principles challenges and key lessonsmethods for noninvasive monitoring of muscle fiber survival with an aav vector encoding the mseap reporter genean effective tool for gene therapysuppressive vaccination with dna encoding a variable region gene of the t cell receptormolecular medicine and gene therapy an introduction6 biologic principles with an impact on primary therapygene therapy an overview of the current viral and nonviral vectorsan improved bronchodilator with anti inflammatory potentialet al 2005 quot stent thrombosis is associated with an impaired response to antiplatelet therapy quot j am coll cardiol 45 11 pp 1748 1752is less active than the mature enzyme with an a2b2c2 structure;with an array of conserved cysteine residuesethics of gene therapysynchronizing a dataset with an xml documentNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM