Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx
Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx
... initial management. Tables 1, 2, 3contain pertinent clinical and treatment informationobtained from the medical record. To ensure accuracy in reporting, disease status was confirmed for all patientsprior ... 1Radiation Oncology Department, Hospital do Cancer A. C. Camargo, Sao Paulo, Brazil and 2Pediatric Oncology Department, Hospital do Cancer A. C. Camargo, Sao Paulo, BrazilEmail: Gustavo A Viani* ... was performed. intrac-avitary brachytherapy was done in 4 patients follow as:one vaginal, one urethral and two nasopharynx sites.There were no local or regional failures in the grouptreated...
- 6
- 260
- 0
Báo cáo khoa học: "Automatic Annotation for All Semantic Layers in FrameNet" potx
... con-tains aspectual information for verbs; andcopulas, support expressions, and slot fillinginformation for nouns and adjectives.• The “Other” layer, containing special casessuch as null arguments.The ... predicates (“it rains”). These null argu-ments are tagged as NULL on the Other layer.3.4 Aspectual ParticlesVerb particles that indicate aspectual informationare marked using the ASPECT label. ... the Evaluation of Systems for theSemantic Analysis of Text, pages 9–12 , Barcelona,Spain, July. Association for Computational Linguis-tics.138Often [an informal group]INGESTORwill eat[lunch]INGESTIBLES[near...
- 4
- 414
- 0
Báo cáo khoa học: "Lexicon Features for Japanese Syntactic Analysis in Mu-Project-JE" pot
... Lexicon Features for Japanese Syntactic Analysis in Mu-Project-JE Yoshiyuki Sakamoto Electrotechnical Laboratory Sakura-mura, Niihari-gun, Ibsraki, Japan Masayuki Satoh The Japan Information ... Science and Technology Nagata-cho, Chiyeda-ku Tokyo, Japan Tetsuya Ishikawa Univ. of Library & Information Science Yatabe-machio Tsukuba-gun. Ibaraki, Japan O. Abstract In this paper, ... on Language Translation, COTING84, Stanford, 1984. (2) Tsujii. J., Nakamura, J. and Nagao, M.; Analysis Grammar of Japanese for Mu-project. COTING84. {3) Nakamura. J Tsujii. J. and Nagao....
- 6
- 333
- 0
Báo cáo khoa học: "Morphological Richness Offsets Resource Demand- Experiences in Constructing a POS Tagger for Hindi" potx
... Shrivastava, N. Agrawal, S. Singh, P. Bhat-tacharya. 2005. Harnessing Morphological Anal-ysis in POS Tagging Task. In Proceedings of theICON 2005P. R. Ray , V. Harish, A. Basu and S. Sarkar ... identification.References A. Ratnaparakhi. 1996. A Maximum Entropy Part-Of-Speech Tagger. EMNLP 1996 A. Bharati, V. Chaitanya, R. Sangal 1995. NaturalLanguage Processing : A Paninian Perspective ... strong and har-nessable, then lack of training corpora isnot debilitating. We establish a method-ology of POS tagging which the re-source disadvantaged (lacking annotatedcorpora) languages can...
- 8
- 261
- 0
báo cáo khoa học: "Hybrid approach for left-sided colonic carcinoma obstruction; a case report" docx
... operation. AT and TA wrotethe paper. All authors read and proved the final manuscript.Competing interestsThe authors declare that they have no competing interests.Received: 4 January 2011 Accepted: ... palliative treat-ment in advanced cancer and using as a bridge tosurgery [21]. For bridging therapy, there are severaladvantages in various groups because the need of emer-gency surgery can ... ofmagnesia 30 ml once a day for bowel preparation. Oneweek later, we scheduled him for SILC. Single incision laparoscopic colectomy (SILC)After general anesthesia was administered. Patient wasplaced...
- 4
- 293
- 0
báo cáo khoa học: "Diagnostic challenge for ovarian malignant melanoma in premenopausal women: Primary or metastatic?" pptx
... report of a metastatic ovarian malignant melanoma simulating primary ovarian cancer.Case report: A 45-year-old premenopausal woman was incidentally found to have an abdominal mass, 3 years afterremoval ... clinically as an ovarian mass (2).Solitary metastatic malignant melanoma to the ovarymay be confused with primary ovarian carcinoma. W epresent this case report of metastatic ovarian malignantmelanoma ... revealed a management for a left plantar melanoma with palpable inguinallymph node without skip metastasis in December 2006.Preoperative thoraco-abdominal and pelv ic CT sc an andcerebral magnetic...
- 4
- 264
- 0
Báo cáo khoa học: "Intraabdominal and retroperitoneal soft-tissue sarcomas - outcome of surgical treatment in primary and recurrent tumors" potx
... million inhabi-tants. During this period, all peripheral surgical depart-ments in the area began referring sarcoma patients to thecenter for diagnosis, evaluation, and surgery.Data on primary and ... histopathological types of sarcoma have been described [7,8].Diagnosing intraabdominal and retroperitoneal sarco-mas(IaRS)isoftendifficultsincethesignsandsymptoms are o ften discreet and uncharacteristic. ... Ba seline characteristics are shown in Table 1. All operations were performed by the same3 surgeons.Statistical analyses For primary and recurrent sarcomas, we compared cate-gorical variables...
- 5
- 563
- 0
Báo cáo khoa học: "Supracricoid hemilaryngopharyngectomy for selected pyriform sinus carcinoma patients – a retrospective chart review" doc
... wereincluded in the preoperative evaluation and tumor stag-ing, as well.The postoperative care was standardized for all patients. A low pressure cuffed tracheostomy cannula was main-tained at ... least until the third postoperative day. The deci-sions for removal of the nasogastric tube and initiation oforal feeding were taken in the lack of aspiration episodesindicating adequate swallowing ... study, and participated in itsdesign and coordination. All authors read and approvedthe final manuscript.References1. Pingree TF, Davis RK, Reichman O, Derrick L: Treatment ofhypopharyngeal carcinoma:...
- 5
- 324
- 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... TCG AGT CAT CCG GAA AAT CCTCCA GAC T), for pGEX–EAD; RGG1 forward d(CGGAAT TCC CAG GAG AGA ACC GGA GCA T) andRGG1 reverse d(CGC TCG AGT CAA TCA AGA TCTGGT CCT TCA TCC ATG G), for pGEX–RGG1; ... remain poorly characterized. EWS belongsto a family that includes the closely related proteinstranslocated in liposarcoma and the TATA-bindingprotein-associated factor 15 which are involved in several ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin–1.Name SequencessDNAS d(CATTCCCACCGGGACCACCAC)ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC)ETS-1 d(TCTCTCGGTGGCCGGGGCTCGTCGGGGTTTTGGGTCCGTCC)Htelo...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: "The Impact of Query Refinement in the Web People Search Task" docx
... results in each campaign. Since the re-lease of the first datasets, this task is becoming anincreasingly popular research topic among Infor-mation Retrieval and Natural Language Process-ing researchers. For ... person. In a typicalhiring process, for instance, candidates are eval-uated not only according to their cv, but also ac-cording to their web profile, i.e. information aboutthem available in the ... named James Patterson). In some cases a cluster might not have any can-didate for a particular type of QR. For instance,manual person attributes like phone number aresparse and won’t be available...
- 4
- 459
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP