0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Báo cáo khoa học:

Báo cáo khoa học: "Enhancing Unlexicalized Parsing Performance using a Wide Coverage Lexicon, Fuzzy Tag-set Mapping, and EM-HMM-based Lexical Probabilities" ppt

... Negev{yoavg|adlerm|elhadad}@cs.bgu.ac.il2Institute for Logic, Language and Computation, University of AmsterdamR.Tsarfaty@uva.nlAbstractWe present a framework for interfacing a PCFG parser with ... applicablein any setting in which there exist a small tree-bank and a wide-coverage lexical resource. Forexample parsing Arabic using the Arabic Tree-bank and the Buckwalter analyzer, or parsing ... Enhanced annotation and parsing of the ara-bic treebank. In INFOS 2008, Cairo, Egypt, March27-29, 2008.Yael Netzer, Meni Adler, David Gabay, and MichaelElhadad. 2007. Can you tag the modal? you...
  • 9
  • 330
  • 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

... FNRox6200AdR/Adxc0.77 AdRred+ Adxox7.2 a Standard deviation for all shown Kdvalues is ± 15%.bData from [10].cData from [34].dData at ratio 1 : 1.eData at [Adxrd(4–108)]/[FNRox] ratio ... a heterologous system that consistsof cyanobacterial FNR and adrenal bovine Adx. AnabaenaPCC 7119 FNR contains a noncovalently bound FADgroup and its main physiological function is the transfer ... recorded after addition ofCYP1 1A1 to an anaerobic CO-saturated sample containingthe reaction mixture FNRrd/Adxoxgave rise to a peak at450 nm together with absorbance decreases at 390, 430 and 480...
  • 10
  • 400
  • 0
báo cáo khoa học:

báo cáo khoa học: "Retroperitoneal liposarcomas: the experience of a tertiary Asian center" pps

... organresection were analyzed with regards to disease-free sur-vival and overall 3- and 5-year survival rate. This wassummarized in Table 2.In our series, females have a 3- and 5-year overall ... was abdominal discomfort and distension (24%) and 2 patients presented with symp-toms as a result of mass effect namely bilateral lowerlimb edema and urinary frequency. An abdominal masswas ... older than 50 years ofage have a 90% and a 45% 3- and 5-year OS respec-tively, as compared to 83.3% and 55.6% for 3- and 5 year-OS in patients who are younger than 50 years ofage. Three year DFS...
  • 6
  • 329
  • 0
báo cáo khoa học:

báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt

... EMBASE, Databaseof Abstracts of Reviews of Effects (DARE), and theCochrane Database of Systematic Reviews (CDSR). Inaddition, we systematically hand-search the CDSR and DARE databases as interventions ... program, within the Canadian Agency forDrugs and Technologies in Health (CADTH), and in collaboration with the Cochrane E ffective Practice and Organisation of Care (EPOC) Group and theCochrane ... summaryformat for each review and ensures the accurac y of theinformation.Analysis and synthesisWe analyse, summarise, and report separately theresults of all relevant comparisons within each...
  • 9
  • 245
  • 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R)10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R)Real time PCR ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R)2 reverse GAAGGCACGCTGAGGAAGAC A1 R5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R4 both outer reverse ACGAAACCTGGCAGAGTCCAAG...
  • 11
  • 662
  • 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

... Core Facility (Yale University,New Haven, CT, USA). Primers to amplify mature NlpI(residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgtaaaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢.3-TPR ... preceding AB pair (Fig. 1A) . LocalAB, BA¢ and nonlocal AA¢ helix packing generate anextended superhelical array with right-handed twist.The motif is often terminated by an additional A, or‘capping ... 5¢-attattggatccctattgctggtccgattctgccag-3¢.3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgggggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttccttatccgatttttcgaagtgc-3¢. PCR products were doubly diges-ted with...
  • 14
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Stochastic Gradient Descent Training for L1-regularized Log-linear Models with Cumulative Penalty" potx

... Japan{yoshimasa.tsuruoka,j.tsujii,sophia.ananiadou}@manchester.ac.ukAbstractStochastic gradient descent (SGD) usesapproximate gradients estimated fromsubsets of the training data and updatesthe ... 959–967.Jianfeng Gao, Galen Andrew, Mark Johnson, and Kristina Toutanova. 2007. A comparative study ofparameter estimation methods for statistical naturallanguage processing. In Proceedings of ACL, pages824–831.Han-Shen ... tasks such as part-of-speech (POS) tagging (Lafferty et al., 2001),syntactic parsing (Clark and Curran, 2004) and se-mantic role labeling (Toutanova et al., 2005). Log- linear models have a...
  • 9
  • 483
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx

... state-of-the-art abbreviationrecognizers as baselines: Schwartz and Hearst’smethod (SH) (2003), SaRAD (Adar, 2004), AL-ICE (Ao and Takagi, 2005), Chang and Sch¨utze’smethod (CS) (Chang and ... var-ious methods by which to extract abbreviationdefinitions that appear in actual texts (Taghva and Gilbreth, 1999; Park and Byrd, 2001; Wren and Garner, 2002; Schwartz and Hearst, 2003;Adar, ... forms asthe training/evaluation data.The evaluation metrics used in the abbreviationgeneration are exact-match accuracy (hereinafteraccuracy), including top-1 accuracy, top-2 accu-racy, and...
  • 9
  • 389
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Part of Speech Tagging Using a Network of Linear Separators" pdf

... taggers, based on Brill's TBL, and with a naive Bayes (e.g.,(Duda and Hart, 1973) based tagger. We used the same training and test sets. The results are summarized in table 4. [ BaselinelNB ... translation, speech recognition, and appears to be an im- portant intermediate stage in many natural lan- guage understanding related inferences. In recent years, a number of approaches have ... Systems for natural language processing: A general framework, pages 315-328. Springer. R. Duda and P. Hart. 1973. Pattern Classifica- tion and Scene Analysis. Wiley. A. R. Golding and D. Roth....
  • 7
  • 367
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

... Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities. Alessandro Clivio, Giorgia Nicolini, Eugenio Vanetti, Antonella ... versions will be made available soon.Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities.Radiation Oncology ... Vanetti E, Clivio A, Fogliata A, Korreman S, Bocanek J, Cozzi L: The GLAaS algorithm for portal dosimetry and quality assurance of RapidArc, an intensity modulated rotational therapy. Radiat...
  • 29
  • 344
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ