Báo cáo khoa học: "Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation" ppt

... 4:27.doi:10.1186/1748-717X-5-106Cite this article as: Mahantshetty et al.: Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation. Radiation Oncology ... volumetric modulated arcs (RapidArc, RA) and fixed field intensity modulated therapy (IMRT) for Whole Abdomen Radiotherapy (WAR) after ovarian cancer.Methods and Materials: Plans for IMRT and RA were ... Clivio A, Fogliata A, Franzetti-Pellanda A, Nicolini G, Vanetti E, Wyttenbach R,Cozzi L: Volumetric arc modulated radiotherapy for carcinomas of theanal canal. A treatment planning comparison...

Báo cáo khoa học: " Whole brain radiation therapy in management of brain metastasis: results and prognostic factors" ppsx

... 9508 randomised trial. Lancet 2004,363:1665-1672.21. Aoyama H, Shirato H, Tago M, Nakagawa K, Toyoda T, Hatano K,Keniyo M, Oya N, Hirota S, Shioura H, Kunieda E, Inomata T, Hay-akawa K, Katoh ... patients with brainmetastasis treated with whole brain radiotherapy (WBRT) and estimate the potential improvement in survival for patients with brain metastases, stratified by the Radiation Therapy ... perform status, RPA class I, and treated withsurgery followed by whole brain radiotherapy had better survival.This data suggest that patients with cancer and a single metastasis to the brain may be...

báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

... design, data analy-sis, and helped to draft the manuscript, APM participated in the study design and coordination and helped draft themanuscript. All authors read and approved the final man-uscript.AcknowledgementsThis ... communities, a data-base containing the names of older adults interested in clinical trials research, and advertisements placed in thelocal newspaper. We were primarily interested in targetingolder adults ... [6], inadequate dietary pro-tein intake [8], inflammation (measured by IL-6 and othercytokines) [4], and physical activity. Indeed, several rand-omized controlled trials have demonstrated that...

Báo cáo khoa học: "SemiIntensity-modulated radiation therapy (IMRT) vs. 3D conformal radiotherapy (3DCRT) in locally advanced rectal cancer (LARC): dosimetric comparison and clinical implications" pptx

... Access Intensity- modulated radiation therapy (IMRT) vs.3D conformal radiotherapy (3DCRT) in locallyadvanced rectal cancer (LARC): dosimetric comparison and clinical implicationsLeire Arbea*, ... using classic anatomical landmarks (c3DCRT), 3DCRT fitting the PTV (f3DCRT), and intensity- modulated radiation therapy (IMRT) in patients with locally advanced rectal cancer (LARC).Materials ... contribution.Authors’ contributionsJA and MM: idea and concept. LA and LIR: design and development ofstudy LIR: statistical analysis. LA: writing of manuscript and study coordinator.RMM and JA: final...

Báo cáo khoa học: "Orthovoltage intraoperative radiation therapy for pancreatic adenocarcinoma" pot

... Valentini V, Morganti AG, Macchia G, et al: Intraoperative radiation therapy in resected pancreatic carcinoma: long-term analysis. Int J Radiat OncolBiol Phys 2008, 70:1094-1099.17. Ruano-Ravina ... Stage II and 1 Stage III; one involving head and body,Stage III; one involving head and tail, Stage II; 2 invol-ving body alone, 1 Stage 1 and 1 Stage II; one involvingbody and tail, Stage ... article as: Bachireddy et al.: Orthovoltage intraoperative radiation therapy for pancreatic adenocarcinoma. Radiation Oncology2010 5:105.Submit your next manuscript to BioMed Central and take...

Báo cáo khoa học: " Stereotactic body radiation therapy for melanoma and renal cell carcinoma: impact of single fraction equivalent dose on local control" ppt

... ofmetastatic renal cell carcinoma. Int J Radiat Oncol Biol Phys 1985,11:2007-2009.5. Halperin EC, Harisiadis L: The role of radiation therapy in themanagement of metastatic renal cell carcinoma. Cancer ... AccessStereotactic body radiation therapy for melanoma and renal cell carcinoma: impact of singlefraction equivalent dose on local controlMichelle A Stinauer1, Brian D Kavanagh1, Tracey E Schefter1, ... Gonzalez1, Thomas Flaig1, Karl Lewis1,William Robinson1, Mark Chidel2, Michael Glode1 and David Raben1*AbstractBackground: Melanoma and renal cell carcinoma (RCC) are traditionally...

Báo cáo khoa học: "Effects of radiation therapy on tissue and serum concentrations of tumour associated trypsin inhibitor and their prognostic significance in rectal cancer patients" doc

... not affected byneoadjuvant radiotherapy in rectal cancer patients. Thefinding of an association between both t-TATI and s-TATI, in particular the latter, and an impaired survivalis in line ... receiving adjuvant chemotherapy comparedto patients not receiving adjuvant chemotherapy (datanot shown).Association between TATI in tissue and serum and clinicopathological characteristicsT-TATI ... clinicopathological parameters, including s-CEA and s-creatinine. Classification and regression tree (CRT)analysis was used to assess optimal cut-offs for t-TATI and s-TATI i n relation to OS. Kaplan-Meier...

Báo cáo khoa học: "Whole shoot hydraulic resistance in Quercus species measured with a new high-pressure flowmeter" pps

... (Tyree et al, 1993) and for Acersaccharum and Populus deltoides (Tyree and Alexander, unpublished data). Theleaf-blade resistance includes vascular and nonvascular pathways from ... ifmost water evaporation occurs near thestomata in accordance with the evidence in support of peristomatal evaporation in substomatal cavities (Tyree and Yianoulis,1980; Yianoulis ... (Tyree and Cheung, 1977).Leaf-blade resistances are relevant to a better understanding of stomatal physio-logy because they allow us to estimategradient in water potential between...

Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf

... double stranded oligos Oct-1, 5¢-TGTCGAATGCAAATCACTAGAA-3¢; Sp1, 5¢-ATTCGATCGGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAGCAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; ... GAA AAG GGC GGG AGG TAC CGC ATC ACA GTC TCMu-S)77/)71 GCA AAT GCG CCA GGT ACC TTC TGG GAA CTCMu-AS)77/)71 GAG TTC CCA GAA GGT ACC TGG CGC ATT TGCMu-S)68/)59 CCG CCC TTT TGA GGT ACC AGA GAA ... 5¢-GGGCTGCTTGAGGAAGTATAAGAAT-3¢;Stat3,5¢-GATCCTTCTGGGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATTGGGCAATCTGCA-3¢ are from Santa Cruz Biotechno-logy. The binding reactions were size-fractionated on a nondenaturing, 5% acrylamide gel, run at 150 V at...

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... GAGTTATCAACGACGAGTGTCCMIH-LR GAGACGACAAGGCTCAGTCC 249AK-LF AAAGGTTTCCTCCACCCTGTAK-LR ACTTCCTCGAGCTTGTCACG 450CHH-SF GACTTGGAGCACGTGTGTCHH-SR TATTGGTCAAACTCGTCCAT 143MIH-SF AAGACAGGAATGGCGAGTMIH-SR AATCTCTCAGCTCTTCGGGAC ... can as yet be said. Our experiments(data not shown) indicate that MIH is episodically and, to a certain extent, stochastically released in intermoult animals, and has a short half-life of between ... totalRNA, an acceptable correlation between MIH and CHHcopy number ratios for intemoult and MT was obtained(Fig. 4), which was better than that for AK normalizeddata. Notwithstanding this, it was...

Xem thêm