Báo cáo khoa học: " Radiobiological restrictions and tolerance doses of repeated single-fraction hdr-irradiation of intersecting small liver volumes for recurrent hepatic metastases" doc

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells Seyed A. Mousavi 1 , Knut E. Berge 1 , Trond Berg 2 and Trond ... low-density lipoprotein receptor; LPDS, lipoprotein- depleted serum; PCSK9, proprotein convertase subtilisin ⁄ kexin type 9; PCSK9-WT,...
Ngày tải lên : 14/02/2014, 14:20
  • 13
  • 712
  • 0
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf

... pore formation by the T3SS FEBS Journal 278 (2011) 414426 ê 2010 The Authors Journal compilation ê 2010 FEBS 421 REVIEW ARTICLE Membrane targeting and pore formation by the type III secretion system ... release their cognate chaperones and are injected through the translocon pore and into the target cytoplasm. IM, inner membrane; MO, outer membra...
Ngày tải lên : 14/02/2014, 22:20
  • 13
  • 647
  • 0
Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D 2 in vivo Yasushi Fujitani 1, *, Kosuke Aritake 1 , ... more in WAT of TG mice than in WAT of WT mice. Serum levels of triglyceride, glucose, leptin and insulin, and insulin sensitivity, in TG mice After 6 weeks of normal or HF diet, serum level...
Ngày tải lên : 16/02/2014, 09:20
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

Tài liệu Báo cáo khoa học: "NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPUTER AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY" ppt

... NATURAL LANGUAGE AND COMPUTER INTEBFACE DESIGN MURRAY TUROFF DEPARTMENT OF COMPU%'z~ AND IiVFORMATION SCIENCE IIEW JERSEY INSTITUTE OF TECHNOLOGY SOME ICONOCLASTIC ... first impression of what a computer is like. COMPUTERIZED CONFERENCING Since 1973 at the New Jersey Institute of Technology, we have been developing and evaluating the use...
Ngày tải lên : 21/02/2014, 20:20
  • 2
  • 465
  • 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... muscles and several cancer cell lines [94]. Table 1. Role of nuclear actin- binding proteins interacting with the androgen receptor. AR, androgen receptor; LBD, ligand-binding domain. Actin- binding protein Targeting sequence ... ARTICLE Nuclear actin and actin- binding proteins in the regulation of transcription and gene expression Bin Zheng 1 , Mei Han 1...
Ngày tải lên : 07/03/2014, 01:20
  • 17
  • 573
  • 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... Hydrodynamic analyses of MutS aggregates A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein -DNA complexes Nabanita Nag 1 , G. Krishnamoorthy 1 and Basuthkar ... underline). Name Size (nt) Sequence CLL 121 5Â-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGA...
Ngày tải lên : 07/03/2014, 12:20
  • 16
  • 397
  • 0
Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx

Báo cáo khoa học: ˚ cDNA cloning and 1.75 A crystal structure determination of PPL2, an endochitinase and N-acetylglucosaminebinding hemagglutinin from Parkia platycephala seeds potx

... Malaysia and the south of Thailand. Parkia platycephala is an important forage tree growing in parts of north-eastern Brazil. The seed lectin from Parkia platycephala is a 47.9-kDa single-chain ... Parkia speciosa [14], Parkia javanica [15], Parkia discolor [16] and the glucose ⁄ mannose-specific lectin from Parkia platycephala seeds [17–21]. Parkia (Legum...
Ngày tải lên : 16/03/2014, 13:20
  • 13
  • 487
  • 0
Báo cáo khoa học: "SEMANTIC FEATURES AND SELECTION RESTRICTIONS" pptx

Báo cáo khoa học: "SEMANTIC FEATURES AND SELECTION RESTRICTIONS" pptx

... or metaphoric (as in the sea smiled). 4. SEMANTIC FEATURES AND SELECTION RESTRICTIONS IN LEXICON AND GRAMMAR In early 60-ies semantic features were almost unique theoretical instrument ... semantic features: [+Incompatibility of contraries] (you cannot believe that P and simultaneously believe that not-P, though, e.g., you can assume that P and simultaneously assume th...
Ngày tải lên : 24/03/2014, 05:21
  • 4
  • 535
  • 0
Báo cáo khoa học: "Combining Source and Target Language Information for Name Tagging of Machine Translation Output" ppt

Báo cáo khoa học: "Combining Source and Target Language Information for Name Tagging of Machine Translation Output" ppt

... constituent, such as a name, which could lead to boundary errors in tagging English names. We have therefore used an alternative method to fetch the source language information for information extraction, ... extract the named entities from machine translated text, using name entity information from both source and target language. Our experiments show that wit...
Ngày tải lên : 31/03/2014, 00:20
  • 6
  • 288
  • 0
Báo cáo khoa học: "Organic matter and nitrogen dynamics in a mature forest of common beech in the Sierra de la Demanda, Spain" doc

Báo cáo khoa học: "Organic matter and nitrogen dynamics in a mature forest of common beech in the Sierra de la Demanda, Spain" doc

... C., Gallardo J.F., Evolución y velocidad de descomposición de la hojarasca en tres bosque de la Sierra de Béjar (Salamanca), Anuario del Centro de Edafolog a y Biolog a Aplicada, Salamanca, 1 (1986) ... R., Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of Northern Spain, Ann. Sci. For. 54 (1997) 261...
Ngày tải lên : 08/08/2014, 14:21
  • 14
  • 304
  • 0
Báo cáo khoa học: " Radiobiological restrictions and tolerance doses of repeated single-fraction hdr-irradiation of intersecting small liver volumes for recurrent hepatic metastases" doc

Báo cáo khoa học: " Radiobiological restrictions and tolerance doses of repeated single-fraction hdr-irradiation of intersecting small liver volumes for recurrent hepatic metastases" doc

... higher potential for regeneration might exist. For larger volumes (>200 mL) and repeated HDR applications, the tolerance doses were even below the limits for whole liver irradiation of approximately ... parameters before and after CT-guided brachytherapy. Conclusion We conclude that repeated high dose rate single fraction irradiation of intersecting liver vol...
Ngày tải lên : 09/08/2014, 08:23
  • 12
  • 188
  • 0
Báo cáo khoa học: "Radiobiological evaluation of forward and inverse IMRT using different fractionations for head and neck tumours" pptx

Báo cáo khoa học: "Radiobiological evaluation of forward and inverse IMRT using different fractionations for head and neck tumours" pptx

... RESEARC H Open Access Radiobiological evaluation of forward and inverse IMRT using different fractionations for head and neck tumours Brigida C Ferreira 1* , Maria do Carmo Lopes 2 , ... advantages obtained by an Improved Forward Planning technique (IFP) and two IMRT techniques using different fractionation schemes for the irradiation of head and n...
Ngày tải lên : 09/08/2014, 09:20
  • 13
  • 315
  • 0
báo cáo khoa học: "First-in-class, first-in-human phase I results of targeted agents: Highlights of the 2008 American Society of Clinical Oncology meeting" pot

báo cáo khoa học: "First-in-class, first-in-human phase I results of targeted agents: Highlights of the 2008 American Society of Clinical Oncology meeting" pot

... purposes) Journal of Hematology & Oncology Open Access Review First-in-class, first-in-human phase I results of targeted agents: Highlights of the 2008 American Society of Clinical Oncology meeting Andrea ... successful inhibition of designated targets, these phase I trial results suggest potential for using biomarkers to help predict and monit...
Ngày tải lên : 10/08/2014, 22:20
  • 9
  • 539
  • 0
báo cáo khoa học: "Updates in Gastrointestinal Oncology – insights from the annual meeting of the American Society of Clinical Oncology" potx

báo cáo khoa học: "Updates in Gastrointestinal Oncology – insights from the annual meeting of the American Society of Clinical Oncology" potx

... neurop- athy in the OFF arm. The median OS in the OFF arm was 28 weeks, and that of the FF arm was 13 weeks, thereby fulfilling the study hypothesis. There was also a significant prolongation of PFS in the ... 6 of 13 (page number not for citation purposes) at the 2008 ASCO annual meeting indicates that progress in these cancers is forthcoming. Abstracts from...
Ngày tải lên : 10/08/2014, 22:20
  • 13
  • 406
  • 0
Báo cáo khoa hoc:" Vitamin D and oestrogen receptor polymorphisms in developmental dysplasia of the hip and primary protrusio acetabuli – A preliminary study" ppt

Báo cáo khoa hoc:" Vitamin D and oestrogen receptor polymorphisms in developmental dysplasia of the hip and primary protrusio acetabuli – A preliminary study" ppt

... Hospital of North Staffordshire by two individuals (BK, CD), and the results validated by an independent, blinded observer examining the agarose gels (AF). 10% of the assays were repeated and analysed ... severity of the conditions. Patients and methods We recruited 45 patient with DDH and 20 patients with PPA. In all patients, a diagnosis of DDH or PPA was made on...
Ngày tải lên : 11/08/2014, 08:21
  • 5
  • 519
  • 0

Xem thêm

Từ khóa: