Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... data, performed data
analysis and drafted the manuscript.
PAF participated in collecting posturographic data,
assisted in data analysis and in drafting the manuscript.
GBJ participated in the ... difference in sway parameters among those
that could cope with the perturbations.
The aim of the present study was to investigate the effect
of STN stimulation alone. In daily life, the...
... in 47 patients with RA without
clinically evident cardiovascular disease at the time of
evaluation by carotid ultrasonography. In our study carotid
IMT, categorized in quartiles, was strongly ... with rheumatoid arthritis (RA). They state
that it remains an open question, because no long-term
studies have documented such an association in patients
with RA. We are pleased to...
... survi-
val was tested using a univariate and multivariate analy-
sis. Variables with p < 0,1 in univariate were included in
multivariate analysis. A p < 0,05 in multivariate analysis
was considered ... hypertrophy in patients with AS and
coexisting significant AR, in relation to patients with
isolated AS, was also noted in earlier reports [5,6].
There is ongo...
... hnRNP -A2 in patients with RA [27]. We observed that
approximately half of the RA patients harbor T cells against
hnRNP -A2 . In accordance with the perception of RA as an
inflammatory, Th1 type systemic ... hnRNP -A2 may constitute an important
T cell autoantigen in patients with SLE, indicating a potential
role for it in the pathogenesis of this disorder...
... chromatin
by phosphorylation by a kinase(s) in a synthetic
phase egg cytosol
Chromatin binding of beads bearing GST–NK was incr-
eased by pretreatment w ith a synthetic phase egg cytosol
fraction ... ith anti-(human LBR) Ig, participates in the
targeting [37]. Therefore, the participation o f LBR in the
targeting of nuclear membranes to chromatin may vary a
little from system...
... amino acids) we used: sense primer:
5¢-CG
GGATCCACCATGCATCATCATCATCATCAT
CATCATCTTGACCAATGGATTGAGCATTTG-3¢
(BamHI site underlined, 8 · His-tag bold) and antisense:
5¢-CG
GAATTCTTACTGATTTATATTTGTATTGGT
CAG-3¢ ... using a standard protocol. The
following primers were used: sense (1), 5¢-CG
GGATCC
ACCATGCATCATCATCATCATCATCATCATGATA
TGGAAATTGATGACCCTATG-3¢ (BamHI site under-
lined, 8 · His-tag...
... 5¢-TGTGCAGCCCATAAGGACACA
CAG-3¢ (Axl,sense)and5¢-ATGGTGGCTGTGC
GGGAGGTGGTGA-3¢ (Axl, antisense), which generated
a 595-bp Axl PCR product; 5¢-TGTCCAAGGGT
GTACATATCAACAT-3¢ (Mer,sense)and5¢-AGCC
GAGGATGATGAACATAGAGT-3¢ ... mutated
bases at the middle (in italic) and 15 complementary bases at
the 5¢ and 3¢ ends. The mutation primers MP-B: 5¢-GG
AGTACTAACCCTGGCCTAGCAAAATAGGCTGTCC
C-3¢ and MP-...
... membrane
compared with when it is still in the ER [5]. This is con-
sistent with the theory that it is stably anchored at the
nuclear membrane through its interaction with lamin
A ⁄ C. Interestingly, an autosomal ... R, Ogawa M, Kurano Y, Kawada J,
Okada R, Hayashi YK, Tsukahara T & Arahata K
(1996) Emerin deficiency at the nuclear membrane in
patients with Eme...
... employs ther apeutic s that are
similar to, yet distinct from, vaccines. Indeed, this article
will demonstrate that propagandist anti-vaccination
websites have started transposing vaccine-fears ... both contain adju-
vants and preservatives), as well as not hesitate to state
that the risk of adverse reactions associated with IT is
greater than that of vaccination (though both have
excelle...