0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Spontaneous intratumoral bleeding and rupture of giant gastric stromal tumor ( 30 cm) in a young patient" pot

Báo cáo khoa học:

Báo cáo khoa học: "Spontaneous intratumoral bleeding and rupture of giant gastric stromal tumor ( 30 cm) in a young patient" pot

... for citation purposes)World Journal of Surgical OncologyOpen AccessCase reportSpontaneous intratumoral bleeding and rupture of giant gastric stromal tumor (& gt; 30 cm) in a young patientRuy ... allprimarily in elderly patients. We report an unusual case, in which a giant gastric GIST – in a young patient – presented as spontaneous intratumoral bleeding followed by intraluminal rupture. Case ... peritonealcavity causing massive intraabdominal bleeding and peri-tonitis were also reported [16-18]. Recently, John et alhave reported an unusual case of gastric GIST presented as intratumoral bleeding...
  • 5
  • 240
  • 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

... S1 (5 ¢-GCAAATGCAACTGGAAGCGG-3¢)andA 1(5 ¢-ACAGCCTGCTAGCAAAGAGG-3¢) for amplification of HRT1, and primers S2 (5 ¢-GAAGAATCCTCTAAGGATAA-3¢)andA 2(5 ¢-TACAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. ... AAM92890),AAM92881, AAM92879, BAB92023 (AAM92883,AAM92884, AAM92885, AAM92887, AAM92888),BAB92024 and AAM92882 (AAM92886) (submitted toGenbankTM and DDBJ by Coldren et al. and Sando et al.respectively). ... with theactiveinvolvementofanumberoffactorsinWBPoffreshHevea latex.Materials and methodsPlant materials and RNA isolationLatex and various tissue samples were obtained from ten-year old rubber...
  • 10
  • 516
  • 0
Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

Tài liệu Báo cáo khoa học: Substrate specificity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

... and Brassica rapa) and vegetables such asecabbage (Brassica oleraceae var. capitata), cauliflower(B. oleraceae var. botrytis) and broccoli (B. oleraceaeKeywordsbrassinin; cyclobrassinin; detoxification;dithiocarbamate ... molecular mass: Blue dextran (2 000 kDa), apoferritin (4 43 kDa), b-amylase (2 00 kDa), alcohol dehydrogenase (1 50 kDa), albumin (6 7 kDa), ovalbumin (4 3 kDa) and carbonic anhydrase (2 9 kDa). Equilibration ... phytoalexins brassicanal A, erucalexin,rutalexin, brassilexin, cyclobrassinin and camalexin (0 .10 and 0 .30 mm final concentrations). The phyto-alexin that displayed an inhibitory effect was furtherexamined...
  • 17
  • 595
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster-3 sequences(data not shown). By contrast, R. pachyptila aminoacid ... scutaria. Finally, wechose an outgroup comprising a- CAs from a cyanobacteria(Nostoc sp.) and three proteobacteria (Klebsiella pneumo-niae, Erwinia carotovora ssp. atroseptica and Neisseriagonorrhoeae).All ... GCC ATT AGC 613– 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616–634RpCAtrRprobe TAA GAT TAC CAG AAT TGC 844–861 a Primers designed by Primer Express software...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: ATP-dependent modulation and autophosphorylation of rapeseed 2-Cys peroxiredoxin docx

Tài liệu Báo cáo khoa học: ATP-dependent modulation and autophosphorylation of rapeseed 2-Cys peroxiredoxin docx

... pET-22b(+) vector as template, 5¢-TAATACGACTCACTATAGG-3¢ [for the T7 promoter of pET-22b(+) vector] as 5¢-primer and 5¢-TCTCCGTAGGGGAGACAAAAGT-3¢,5¢-ATCCCGCGGGGGAAACCTCATC-3¢ and 5¢-CTGTTTGGACGAACGCAAGATG-3¢as ... and oxidant, (c) incubated for 10 min with 0.1 mm ATP, and (d) concentrated in a SpeedVac centrifuge. After addition of ammonium bicarbonate (pH 8.5) and urea to a final con-centration of 0.1 and 2 ... (A) Expanded view of peaks at m ⁄ z 2800.36 and 2832.35 and the fragmentation of the peak at m ⁄ z 2800.36. (B) Expanded view of peaks atm ⁄ z 2934.36 and 2950.35 and the fragmentation of the peak...
  • 14
  • 460
  • 0
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

... RT-PCR against the extractedRNA. (A) Lanes 1 and 2, total RNA extract.(B) Lane 1, nucleotide acid marker DL15000(TaKaRa); Lane 2, FP subunit. (C) Lane 1,nucleotide acid marker DL2000 (TaKaRa);Lane ... bovine heart mito-chondria. Science 277, 60–66.13 Tsukihara T, Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoR & Yoshikawa S (1 995) Structures of metal ... kDa, 252 amino acids), and two membrane-anchor proteins (CybL, 15 kDa, 140 amino acids, and CybS, 11 kDa, 103 amino acids) with a total of sixtransmembrane helices. Here we provide a detailedreport...
  • 6
  • 469
  • 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... Plasmid pGEM23S.5 contains a shortened intron (3 80 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (4 5 nucleotides, TAATACGACTCACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)contains, in ... [43]; and for Azoarcus pre-tRNAIle(F) from [44]. Domain–domain interactions in introns B–F are indicated by dashed lines. In (A) , the lightly shaded nucleotides in the L9.1 and P7.1 loops may ... form a novel base-pairing interaction; the gray dashed line between L2 and P8 also indicates a possible interaction. Solid arrows indicate sites of Mn2+cleavage in Cr.LSU and T4-td; open arrows...
  • 14
  • 480
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... example, asparagine to aspartic acid, orglutamine to glutamic acid changes [14]. The a- conotoxinsEpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... course of characterization of native a- conotoxins.Analysis of neuronally active a- conotoxinsusing HPLC and MS, including identification of post-translational modificationsIsolation and identificationStandard ... biological interpretation of thisemerging pattern of paired ligand types is that prey capturemight rely on the combination of muscle-acting antagoniststo cause paralysis and neuronally acting antagonists...
  • 11
  • 554
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... theUniversity of Illinois and a German Academic Ex-change Service (DAAD) Graduate Research Grant.Julia Hockenmaier is supported by the National Sci-ence Foundation through CAREER award 1053856 and award ... halves are classified separately, and if the maximum anglicism classifier score out of allsplits exceeds a target confidence c (= 0.7), the orig-inal word is labeled a candidate anglicism. Parame-ter ... 0.32Table 1: Type- and token-based precision at recall=95from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009).Compound-cutting Nominal and adjectival com-pounding...
  • 5
  • 537
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ