Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot

... Although majority of the nodesare located in internal iliac and external iliac areas, nodeshave been found in also presacral, parametrial and parar-ectal areas [33]. In a sentinel node study carried ... internaliliac, and 17% in the parametrial areas [35], whereas Lev-enback found 9% of the sentinel nodes in the paraaorticarea, 11% in the common iliac, 71% in the external iliac, and 9% in the parametrial ... carcinomas, while the rest are melanoma, adenocarcinoma, basal cell carci-noma and sarcoma [7].Nodal metastasis in vulva cancer is the main prognosticfactor, irrespective of the size of the...

Báo cáo khoa học: "Tree canopy and herb layer transpiration in three Scots pine stands with different stand structures" potx

... plots and the data on sapwood area in the sample trees, standsapwood area was calculated. Stand sap flow was calcu-lated as the product of average sap flow density and stand ... leaf area and the leaf biomass the leafarea index of these species (LAIpart) was calculated. The LAI of the herbaceous layer is the sum of the LAIpart.2.7. Transpiration ... al. [29] for a 30-year-old pine stand at Hartheim in the upper Rhine valley. The LAI of the herb layer at Rösa was higher because of the dominance of the wide-leafed...

báo cáo khoa học: " Fever, hyperglycaemia and swallowing dysfunction management in acute stroke: A cluster randomised controlled trial of knowledge transfer" pot

... admis-sion, and length of stayFor missing data, patient clinical data will be obtainedfrom the TASC database. Patients themselves will alreadyhave agreed to allow access to these data as part of the study ... inter-professional(involving all team professionals), and patient-based(offering and refining clinical treatment protocols).Clinical nursing staff at the intervention ASUs will be ableto undertake optional audits ... undertaken in the Stata statistical package[51].Sample SizeTASC data from January 2003 to May 2005 demonstratedthat 35% of patients had a mRS ≥2 at hospital discharge, and the mean hospital...

báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

... results.Once the relevant data had been extracted and the studiessummarized, the remainder of the analysis was carried outusing the data extraction form and the analytical frame-work presented in the ... Lanka and Tanzania [22-35].Key interventions that were most often absent includedassisted vaginal delivery and manual removal of the pla-centa. Among the explanations offered for these clinicaldeficiencies ... (HR) in developing countries. In the health sector in general, and in maternal health in particular, health care professionals are at the heart of the success of EmOC interventions [13]. The performance...

báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx

... coding and interpretation of the data In addition to the methodological flaws noted above,several of the studies we reviewed wer e marred bybiased coding and interpretation of the data. For exam-ple, ... lifetime and never having smoked again and can become men-tally and physically addicted to nicotine even if theyhave never smoked a puff. Below, we examine the the-oretical and empirical basis of these ... noted, they are generally downplayed and donot affect the decisiveness of the conclusions. Interpre-tation of the findings is often biased and obvious caveats and alternative explanations for the...

báo cáo khoa học: " Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1" potx

... CLSM9959.b1_N18.ab1 F - TGCTCAATTACACTCGAACCA 61 1.5 326R - CTTCATGGAGAGAAATACAAGGTCCLSZ1525 CLSZ1525.b1_J22.ab1 F - GAAGAAACTCATGAATCTGCTCAA 62 3 157-158R - TTTGCTCAAGAACTCTTAAACCATTCntg11275 ... development of resistant cultivars. A combination of classical linkage mapping and associa-tion mapping allowed us to pinpoint the location of the resistance gene on chromosomal linkage group 2. Exami-nation ... Tvr1region, and development of molecular markers for marker-assisted selection.Results: A combination of classical linkage mapping and association mapping allowed us to pinpoint the location of the...

Tài liệu Báo cáo khoa học: "Mood Patterns and Affective Lexicon Access in Weblogs" ppt

... based on the Euclidean measure of theircorresponding ANEW usage, using MDS and hi-erarchical clustering respectively.4.2 Mood and ANEW AssociationBased on the IG values between moods and ANEW, ... containing the word aresimilar with the word in the affective scores. In addition, the least likely moods are much differ-ent with the ANEW in the affect measure. A plot of top ANEWs used in the ... representatives for the mood fash-ion of sadness and deactivation. In addition, the grateful group could be a representative for moodswhich are both low in pleasure and in the degree of activation...

Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx

... resistance to viral and bacterial infections,potentiation of anti-tumour activity of macrophages,manipulation of cytokine release and restoration of haematopoiesis [18–20]. The parent molecule of ... the production of ROS in immune cells in a negative feed-back regulatory cycle. Finally, these data suggest the interesting possibility that UCP2 may serve as an anti-oxidant, guarding against ... protection against obesity, regulation of the ATP ⁄ ADP ratio, export of fatty acids, and media-tion of insulin secretion (reviewed in [9]). The hypothesis that has good experimental supportis the...

Báo cáo khoa học: Protein aggregation and amyloid ﬁbril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

... acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a negative set that both sample well the amino acidspace ... is a proline (aggregation breaker). Several other parame-ters are calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro-ﬁle above the HST, the total ... pro-pensities.As the analysis of the hexapeptide experimental datasets (positive and negative) may impose sequence biasspeciﬁc to the available data, the authors of waltzTable 1. Protein aggregation and...

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... perinuclear areas of the cell via its N-ter-minal ABD. In the absence of ligand, AR is localizedpredominantly in the cytoplasm, and its hinge domain and the LBD are tethered to the C-terminal end of FLNa ... transport of the AR, interacts with the AR DBD–LBD in a ligand-independent manner[77,86,87]. The absence of ﬁlamin hampers androgen-induced AR transactivation. In the absence of ﬁlamin, the ... func-tions in the presence of cognate ligands [106]. Further-more, a- actinin-4 also binds to the AR and exhibitscoregulating properties. a- Actinin-4 may target the ARfor degradation and ⁄ or antagonize...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam