Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
... participated in analysis of data.CA performed the statistical analysis and the clinical associa-tions. AS participated in the analysis and interpretation of dataand in the revision of the manuscript. ... articleScreening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestationsPaola Margutti1, Maurizio ... experiments on endothelial cell line and apoptosis andparticipated in the design of the study and helped to draft the manuscript. FC participated in the design of the study and in analysis of data and...
- 8
- 375
- 0
Báo cáo y học: "Equipoise, design bias, and randomized controlled trials: the elusive ethics of new drug development" docx
... value of any single arm. The principle of ‘equal uncertainty between the arms of the RCT’ must be replaced with the principle of a reasonable‘expected value’ for the participant after pooling the ... clearly was being systematicallyviolated. Publication bias appeared to be an incompleteexplanation for this dramatic result; this bias occurs after a studyis completed. Rather, we hypothesize ... (‘risk aversion’).Autonomy implies the ability to make decisions under a personal rather than an externally imposed value system.However, the standard is that of the ‘reasonable person’.Autonomy...
- 6
- 469
- 0
Báo cáo y học: "Objective Structured Clinical Examinations (OSCEs), psychiatry and the Clinical assessment of Skills and Competencies (CASC)Same Evidence, Different Judgement" ppsx
... specialist trainingwhich usually after 3 years leads to qualification as a Consultant. The CASC seeks to test compe tency in Psychiatry. The CASC has replaced the previous system of partI and part II ... approach to examining Psychiatry cases can bevalid. It is much less clear whether an OSCE such as the CASC can assess higher order thinking or advanced psy-chiatric skills that a senior Psychiatrist ... examinations which involved 2 longcases with each long case involving a partly observedinterview of a real patient. Part II also involved an oralexamination involving some standardized patient...
- 6
- 324
- 0
Báo cáo y học: "Diffusion-weighted magnetic resonance imaging for predicting the clinical outcome of comatose survivors after cardiac arrest: a cohort study" pptx
... Karaarslan E, Arslan A: Perirolandic cortex of the normal brain: low signalintensity on turbo FLAIR MR images. Radiology 2003, 227:538-541.34. Kawahara H, Takeda Y, Tanaka A, Nagano O, Katayama ... between the twogroups.Quantitative analysis of the ADC valuesROI analysis The ADC value was measured in 22 patients: 8 had a favourable outcome, and 14 had an unfavourable out-come. Among the ... (ADC)alteration [16]. The ADCs of cortex and basal ganglia mea-sured during the early life (≤ six days) of neonates suffer-ing with perinatal asphyxia has also been reported tocorrelate with the...
- 11
- 267
- 0
Báo cáo hóa học: " Research Article An ML-Based Estimate and the Cramer-Rao Bound for Data-Aided Channel Estimation in KSP-OFDM" pdf
... Communications and Networkingand replacing in the data part of the signal some data carriersby pilot carriers. As the former strategy results in a strongerreduction of the OFDM system efficiency than ... corresponding to the datapart of the received signal are transformed to the frequencydomain by an FFT, and the guard interval samples are nottransformed. In ZP-OFDM, first the samples from the guardinterval ... that the NCRB slightly increases for increasingguard interval length. This can be explained by noting thatwhen ν increases, the number of guard interval pilots in- creases while the number of...
- 9
- 283
- 0
Báo cáo y học: "Is there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection" ppt
... was alsoraised but to a more modest extent. Thus, there was an CommentaryIs there an association between anti-TNF monoclonal antibodytherapy in rheumatoid arthritis and risk of malignancy andserious ... importantincreased risk below these levels. Many malignancies in the anti-TNF arms of the trials were nonmelanoma skin cancers(9/35), and a further four were identified within 6 weeks of starting therapy. ... of infections andcancer occurring in the different treatment arms of the published anti-TNF monoclonal antibody trials.Summary of methods and findings The meta-analysis identified nine trials...
- 3
- 360
- 0
Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt
... (HAQ) to assess functional ability [9]. The radiological damage was assessed in X-ray scans of the handsand wrists biannually (2000, 2002, and 2004), which wereread centrally by a trained radiologist ... LEF,sulfasalazine cyclosporine A, aTNF and others), the followingcovariates were also analyzed: age at disease onset, age atbaseline, gender, years of disease duration, presence of comorbidity (hypertension, ... The baseline DAS28-3 was associated with a signifi-cant progression of DAS28-3 and Larsen score (Table 2). In addition, extra-articular RA was also associated with higherDAS28-3 values and,...
- 10
- 426
- 0
Báo cáo y học: "ISsaga is an ensemble of web-based methods for high throughput identification and semiautomatic annotation of insertion sequences in prokaryotic genomes" pdf
... GGTGAGACCCTAGTCCTTTCCACAGCTCTCAAAATTTCCTCACACTC CTCCACAGA GGTGAGAC AGTTGCAGCAGGACTATTCCATTCGCCAAATTTGTCAGGTATTCATTGACCTAGTTTTTGACAAGAAAGGGGGGCTCGTTTGAGCCCCCCAAAATAAACCCACTCTTAACTTTTTCAACCAAGCGACATCACTTAAAG CACTTAAAGTTGGTAGTGAAATACACCCAACCAATGCAGCAATTCCTGTCTCCACAGA ... thermocellum,twostrainsofStenotrophomonas maltophilia,twostrainsofAnae ro-myxobacter sp., two strains of Anaeromyxobacter dehalo-genans and Aquiflex aeolicus (Table 1). Clearly, the annotations included in the ... AGTTGCAGCAGGACTATTCCATTCGCCAAATTTGTCAGGTATTCATTGACCTAGTTTTTGACAAGAAAGGGGGGCTCGTTTGAGCCCCCCAAAATAAACCCACTCTTAACTTTTTCAACCAAGCGACATCACTTAAAG CACTTAAAGTTGGTAGTGAAATACACCCAACCAATGCAGCAATTCCTGTCTCCACAGA AGCGCCATCATTCCAGTACAAAATTCCCCAGGGCCATTC1324IS ID FLANKING REGION LEFT DR SIZE ? FLANKING REGION RIGHT10009Insertion...
- 9
- 672
- 0
Báo cáo y học: " TopHat-Fusion: an algorithm for discovery of novel fusion transcript" doc
... (25bp)TTAACACTATCTAAAATCAATTTTC AATGATAGCGACGACTGCGTCATAGchr iGAATTTCCTG TTAACACTATCTAAAATCAATTTTC TTTTACAGGTACATTGTAGTTTTAT GAATATGGCTCCGGTCAACAGTAAC AATGATAGCGACGACTGCGTCATAG TCAGTGAATCchr ... coordinate) (a) mapping segments on chr i and chr jTTTTACAGGTAC GGTCAACAGTAACTTAACACTATCTAAAATCAATTTTC TTTTACAGGTAC GGTCAACAGTAAC AATGATAGCGACGACTGCGTCATAGchr iGAATTTCCTG TTAACACTATCTAAAATCAATTTTC ... contigsATTCCCGTAATCTACGATTAAG TCACAACCAAACCATGGATTACGGTCTGCGTTGGAATCAGGGCC GTGCCAAGTGCAGTTGTAGTGCATCAATTTTCTTTTACAGGTAC GGTCAACAGTAACAATGATAGCAGACGCCCACCAATGAGTAAAG AGGGATTGAGCGCGACTTCTCTGCCATATTGATTGGCCAGCAAG...
- 15
- 381
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ