Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

... strains. The G1 rotavirus VP7 gene specific primers were described by Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea ... 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed CentralPage 1 of 5(page number not for citation purposes)Virology JournalOpen ... Because of the natural variation in the rotaviral gene sequences, close monitoring of rotavirus genotyping methods is important.BackgroundRotaviruses remain the most common cause of acute gas-troenteritis...

báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx

... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATA ... Breiman1, David A Sack1, Marc Van Ranst2 and Tasnim Azim1Address: 1ICDDR,B: Centre for Health and Population Research, Mohakhali, Dhaka-1212, Bangladesh and 2Laboratory of Clinical and ... Iturriza-Gomara M, Kang G, Mammen A, Jana AK, Abraham M, Des-selberger U, Brown D, Gray J: Characterization of G10P[11]rotaviruses causing acute gastroenteritis in neonates andinfants in Vellore,...

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... is of Mexican origin. The index casewas a 23-year-old female diagnosed with breast carci-noma of the left breast with combined histological fea-tures of lobular carcinoma and infiltrating ... Journal of Surgical OncologyOpen AccessResearchIdentification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndromeLucia Taja-Chayeb*†1, Silvia Vidal-Millán†1, ... ductalcarcinoma. The family history suggested LFS: the patient'sfather was diagnosed with dorsal soft tissue leiomyosar-coma at the age of 67 years, and a half-sister (from the paternal...

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

... (Suwon, Korea) for manufacturing PEDV live vaccineby the National Veterinary Research and QuarantineService (Anyang, Korea). KPEDV-9 was propagated in Vero cells with virus replication medium ... protein binding assay(VOPBA) was used to identify PEDV binding protein in permissive cells. The binding ability of PEDV to porcineAPN (pAPN) and the effects of pAPN on infectivity of PEDV in Vero ... virus-binding studies were carried out by enzyme linkedimmunosorbent assay (ELISA). A micro-ELISA plate(Nalge Nunc International, USA) was coated with 0.5µg of pAPN per well in carbonate-bicarbonate...

báo cáo khoa học: " Identification of novel maize miRNAs by measuring the precision of precursor processing" ppsx

... 21 AAAUUAUAGGGCAUUUUUAUA 0 0 0.68 0.52 family3 3 miRNA37 20 GUUAUUUUCGGUAGCAUAAG 0 0 0.41 0.1 family3 4 miRNA38 21 AAAAAGAAACGGAGGGAGUAC 1.32 0.58 0.07 2.82 family3 5 miRNA39 21 AUACUAGGAGUGAAGGGAUCA ... miRNA56 21 UUUGGGAGCAAGUGGAAUGGA 0.15 0 0 0.52 family5 3 miRNA57 20 GAGACAAUUGCAUAUUUAGG 0 0.42 0.41 0.42 family5 4 miRNA58 20 GAAGAGGAACACAAACAGAG 0 0.5 0 0 family5 5 miRNA59 21 UAAGACGUUUUGACAUUUCUA ... 1.15 family2 9 miRNA33 20 AGAGACAAAAUACUGUAGAA 0 0.42 0.95 0 family3 0 miRNA34 21 UGGACAGGGAAAUGAAGGGGA 0.15 0 0 3.14 family3 1 miRNA35 21 UAGUACAUGGACCUAGAUGAC 0.59 1.5 0.47 18.81 family3 2 miRNA36...

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgagG K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaaFigure 3 Full-length cDNA and deduced protein of CcGCC1 gene. Start and stop codons are underlined. ... Thaumatin-like protein isoform 21 taaatactatccatggaagcacaatcacaagaaaagcaaaacctggagcctgttatagaaM E A Q S Q E K Q N L E P V I E 61 gcttcattaccaccatcaaatcaattttccggggataatttttccgagaagttgtctgagA...

báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx

... resulting in an approximately seven-fold increase in the total amino acid content. The expression of the AS gene, encoding a transaminaseresponsible for the synthesis of asparagine from aspar-tate ... Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y,Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T: Spermidinesynthase genes are essential for survival of Arabidopsis. Plant Physiol2004, ... Imai A, Akiyama T, Kato T, Sato S, Tabata S, Yamamoto KT, Takahashi T:Spermine is not essential for survival of Arabidopsis. FEBS Letters 2004,556:148-152.39. Imai A, Matsuyama T, Hanzawa...

báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

... total).Validation with original GWAS SNP data and HapMapdataCRISP called all 15 of the SNPs individually typed aspart of the GWAS as variants. The Spearman correla-tion coefficients of MAF e stimates ... 41:1100-1104.4. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N,Nakagawa M, Korenaga M, Hino K, Hige S, Ito Y, Mita E, Tanaka E,Mochida S, Murawaki Y, Honda M, Sakai A, Hiasa Y, Nishiguchi ... beused in combination with the current standard of care. The predictive value of SNPs is best calculated from rou-tine clinical practice, rather than the clinical trial sce-nario, since these are...

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose accord-ing to plasma level', without having to adjust anything, whichvirtually eliminates the risk of ... designing the study. KC wasresponsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript.BC was responsible for data acquisition, ... Sophisti-cated CDSS in the form of real-time alerts notifying the physician to adjust drug dosages to changing organ failurewas lacking.Statistical analysis The primary outcome measure was the difference...

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... parameteroptimization. The half-height widths of the NMR signalswere used as a measure of the uncertainty of each NMRdata point and an experimental uncertainty of 2% wasassumed for the experimental points ... sulfate-reducing bacteria aresmall soluble proteins containing four haems, and havebeen assigned a fundamental role in the bioenergeticmetabolism of these organisms, mediating the ﬂow of electrons ... by zinc. Comparison of these results with datafor the isolated cytochrome shows that binding of ligands causes only smallchanges in the reduction potentials of the haems and their pairwise inter-actions,...

Xem thêm