Báo cáo khoa học: "Novel deployment of a covered duodenal stent in open surgery to facilitate closure of a malignant duodenal perforation" ppt

... AccessCase reportNovel deployment of a covered duodenal stent in open surgery to facilitate closure of a malignant duodenal perforationPhilip F Lung, Adrian B Cresswell, Josephine Psaila and Ameet ... complications in a locally advanced intra abdominal malignancy.Case presentation: A 38 year old Vietnamese man presented with a carcinoma of the colonwhich had invaded the gallbladder and duodenum ... duodenojejunostomy in the manage-ment of adult megaduodenum. Surgery 2004, 135(2):222-224.7. Morgan R, Adam A: Use of metallic stents and balloons in theesophagus and gastrointestinal tract. J Vasc Interv...

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... 1827–1834.17 Cai G, Michigami T, Yamamoto T, Yasui N, SatomuraK, Yamagata M, Shima M, Nakajima S, Mushiake S,Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspeciﬁc alkaline ... Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization.Endocrine Rev 15, 439–461.K. Komaru et al. Novel aggregate formation of an alkaline phosphatase frame-shift mutantFEBS ... deoxycholate ⁄ 0.05% (w ⁄ v) SDS in NaCl ⁄ Pi]. A protease inhibitors cocktail (antipain, aprotinin, chy-mostatin, elastatinal, leupeptin, pepstatin A) was added to cell lysates and media (10...

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identiﬁcation ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... chromatography; 5, proteins not bound to immobilized lactoferrin binding site (final fraction). (E) Analysis of fractions obtainedfrom the preparative EMSA and DNA affinity chromatography stages ... general rules for siRNA selection [43]. The firstsiRNAZF55¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases192–210; the second siRNAZF5(5¢-GAGGAAGCAUGAGAAACUCUU-3¢ and ... dish was used in all experi-ments. b-galactosidase assays were performed followingstandard protocols, using O-nitrophenyl-b-d-galactopyr-anoside as a substrate. Relative b-galactosidase activitywas...

Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-afﬁnity potentiation and low-afﬁnity inhibition of nicotinic acetylcholine receptors doc

... superfamily,containing several jI-conotoxins, and the A super-family, containing a- conotoxins, aA-conotoxins andjA-conotoxins [1].Competitive antagonists of the nicotinic acetylcholinereceptors (nAChRs) ... superfamily, containing r-conotoxinsand aS-conotoxins; the T superfamily, containinge-conotoxins and v-conotoxins; the P superfamily,containing the spasmodic peptides; the I superfamily,containing ... Possani3,Edgar P. Heimer de la Cotera1, Francesco Peri2, Baltazar Becerril3and Enzo Wanke21 Laboratorio de Neurofarmacologı´ a Marina, Departamento de Neurobiologı´ a Celular y Molecular, Instituto...

Báo cáo khoa học: Novel dissociation mechanism of a polychaetous annelid extracellular haemoglobin pptx

... Ebina S, Matsubara K, Nagayama K, Yamaki M &Gotoh T (1995) Carbohydrate gluing, an architecturalmechanism in the supramolecular structure of an anne-lid giant hemoglobin. Proc Natl Acad ... following observa-tions, namely (a) the decrease of the A 414: A 280 of eachelution peak, which is characteristic of a loss of haemand (b) the increasing formation of nonhaem-contain-ing subunits, ... bandobserved at alkaline pH with time (Fig. 2C) and in thepresence of an increasing concentration of urea(Fig. 2D), reveals a signiﬁcant alteration in the haempocket, leading to a dissociation...

báo cáo khoa học: " Novel surgical technique for complete traumatic rupture of the pancreas: A case report" potx

... lay open after the hematoma was removed. PT:pancreatic tail; PV: portal vein; S: stomach; SV: splenic vein. (C) Thisphotograph was taken after the tail of the pancreas (PT) wasanastomosed as ... anastomosis and an inner duct -to- mucosa anasto-mosis. The outer layer was prepared by placing U-shapedtranspancreatic st itches to the dorsal part of the jejunumwhile carefully avoiding the pancreatic ... combination of suturing the pancreatic head and two-layer pancreaticojejunostomy with thepancreatic tail is a feasible technique to manage this condition.IntroductionBlunt abdominal trauma is...

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... 818–823.69 Inouye S, Fujimoto M, Nakamura T, Takaki E,Hayashida N, Hai T & Nakai A (2007) Heat shocktranscription factor 1 opens chromatin structure of interleukin-6 promoter to facilitate binding ... 2087–2099.40 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimot-o RI & Nagata K (1997) HSF4, a new member of thehuman heat shock factor family which lacks properties of a transcriptional activator. ... 469–481.41 Fujimoto M, Hayashida N, Katoh T, Oshima K,Shinkawa T, Prakasam R, Tan K, Inouye S, Takii R &Nakai A (2010) A novel mouse HSF3 has the potential to activate non-classical heat shock...

Báo cáo khoa học: Novel modiﬁed version of nonphosphorylated sugar metabolism – an alternative L-rhamnose pathway of Sphingomonas sp. doc

... Watanabe S, Shimada N, Tajima K, Kodaki T & Maki-no K (2006) Identiﬁcation and characterization of L-arabonate dehydratase, L-2-keto-3-deoxyarabonatedehydratase and L-arabinolactonase involved ... shown in Fig. S2). Among them,FAH catalyzes the hydrolytic cleavage of a C–C bond in fumarylacetoacetate to yield fumarate and acetoacetate,and the catalytic reaction is partially analogous to ... 27378–27388.15 Watanabe S, Kodaki T & Makino K (2006) Cloning,expression and characterization of bacterial L-arabi-nose 1-dehydrogenase involved in an alternative path-way of L-arabinose metabolism....

Báo cáo khoa học: Novel aspects of calmodulin target recognition and activation pptx

... whichcauses a conformational change and enables Ca2+/CaM to bind to speciﬁc CaM-binding domains. The binding of Ca2+/CaM to its target proteins alters their activity in a calcium dependent manner.The ... the Ca2+-pump.Keywords: calmodulin; CaM-binding domains; Ca2+-signaling; cellular signaling; CaM-target activation.Ca2+signaling and calmodulinThe calcium metal ion (Ca2+) plays an ... details of the actual mechanism of activation are onlypartially understood for most CaM-regulated proteins. A major obstacle in obtaining detailed insights in the struc-tural basis for CaM/target...

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... Datla2,*, Akshaya Bellary1,*, Khalander Basha1, Ashwani Sharma1,Anuradha Sharma1, Shiva Singh1, Shakti Upadhyay2and Vikram Rajagopal11 Drug Discovery and Development Group, Reliance ... the cDNA was carried out using the respectivegene-speciﬁc primers:ICAM-15¢- CTGATGGGCAGTCAACAGCTAAAA - 3¢(sense)5¢- TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense)Cox-25¢-ATGAGATTGTGGGAAAATTGCT- ... Importance of extra- and intracellular domains of TLR1 and TLR2 in NF-kappa B signaling. J CellBiol 162, 1099–1110.34 Dunne A & O’Neill LA (2005) Adaptor usage and Toll-like receptor signaling...

Xem thêm