Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx
Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx
... rearrangements in the patient s parotid gland only, as well as of Vλ1C–Jλ3 rearrangements in both the peripheral blood and parotid gland of this patient with SS.One feature of the present patient ... from the peripheral blood of the same patient. This patient manifested increased titers of autoantibodies (anti-Ro and anti-La), hypergamma-globulinemia and enlargement of the parotid glands, and could ... typical histology of the minor salivary glands (focus score >1). The duration of the disease was 9 years at the time of analysis. The patient expressed elevated titers of anti-52 kDa Ro(SS -A) and...
- 12
- 441
- 0
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... were as follows:1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC.2. TGF-β1, TGGACCGCAACAACGCCATCTATGA-GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC-CAGGGCT.3. β-actin, ... obtained from the Shizuoka Laboratory Animal Center (Hamamatsu, Shizuoka,Japan). All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine (Nishinomiya, Hyogo, Japan).Animal ... and co-ordination of the study, and participated in the interpreta-tion of the results. T Imado and SK performed the animal study and histologic analysis. HS participated in the design of the animal...
- 7
- 399
- 0
Báo cáo y học: "Medicinal plants used for traditional veterinary in the Sierras de Córdoba (Argentina): An ethnobotanical comparison with human medicinal uses" ppt
... valleys of the regions of Calamu-chita and Paravachasca (Santa Mar a and CalamuchitaDepartments) and complemented with surveys carriedout in settlements near the town of La Calera, all in the area ... part/alcoholicmacerate/friction and massageRub the macerate in the back of the animal torelieve kidney pain.Lavandula officinalis var. angustifolia(DeGring.) Briq. (Lamiaceae) (AMP2285)lavanda oalhucemaitching ... number of years the animal has and throwing 9 grains of wheat into the water whilepraying and s aying the number of affected nerves.This treatment can also be performed at a distance,by praying....
- 19
- 444
- 0
Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt
... (HAQ) to assess functional ability [9]. The radiological damage was assessed in X-ray scans of the hands and wrists biannually (2000, 2002, and 2004), which wereread centrally by a trained radiologist ... LEF,sulfasalazine cyclosporine A, aTNF and others), the followingcovariates were also analyzed: age at disease onset, age atbaseline, gender, years of disease duration, presence of comorbidity (hypertension, ... draft the manuscript. MAD per-formed the statistical analysis and helped to draft the manuscript. IG -A participated in the design of the study and also in collection of the data at the Hospital...
- 10
- 426
- 0
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
... preparation. NDassisted in patient recruitment, was a reader for the X-rays and assisted in manuscript preparation. ML assisted in patient recruitment and participated in data analysis. QR was a ... data entry and analysis. FMM conceived of the study and coordinated patient recruitment, data entry, data analysis and preparation of the manuscript.AcknowledgementsWe wish to acknowledge the ... readerfor the X-rays and assisted in manuscript preparation. ER pro-vided statistical advice and assisted in data analysis and man-uscript preparation. WJT assisted in patient recruitment and manuscript...
- 9
- 521
- 0
Báo cáo y học: "Cartilage oligomeric matrix protein is involved in human limb development and in the pathogenesis of osteoarthriti" pptx
... from the areaadjacent to the main defect and pieces of tissue with a macro-scopically normal appearance of the lateral aspect of a con-dyle from each of the 12 patients were minced, and RNA wasisolated ... patients in the late stages of OA, an increase in staining intensity was found in the pericel-lular space (Figure 4b). In healthy cartilage, COMP stainingwas also found in the territorial and ... (COMP) (arrow) and a fainter band at 160 kDa in the same extract, (c) a clear band at 105 kDa, and a smear seen for healthy articular cartilage and (d) shows the molecular weight marker.Arthritis...
- 10
- 480
- 0
Báo cáo y học: "Receptor for advanced glycation end products Glycine 82 Serine polymorphism and risk of cardiovascular events in rheumatoid arthritis" potx
... Silman AJ:Baseline levels of C-reactive protein and prediction of deathfrom cardiovascular disease in patients with inflammatory pol-yarthritis: a ten-year followup study of a primary care-basedinception ... single time point, which occurred at variable times after com-mencing a variety of antirheumatic drugs rather than atbaseline. In RA, proinflammatory ligands of the RAGE, includingS10 0A1 2 and ... ability to discern the influence of inflammation on CV events because we exam-ined only RA patients and not matched non-RA controls and inflammatory markers and radiographs were examined at onlya...
- 8
- 330
- 0
Báo cáo y học: "MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppsx
... KP assisted in patient recruitment and participated in data entry. JL partici-pated in data entry and analysis. FMM conceived of the study and coordinated patient recruitment, data entry, data ... preparation. ML assisted in patient recruitment and participated in data analysis. QR was a readerfor the X-rays and assisted in manuscript preparation. ER pro-vided statistical advice and assisted ... Severity of psoriasis was assessed using the PsoriasisArea and Severity Index (PASI) [16] and the Psoriasis NailSeverity Score (PNSS) [17] was also used.RadiographyPlain XRs of the hands, feet and...
- 9
- 509
- 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx
... KA analyzed and interpreted the patient data. AT, NF,KS, AT, MT and HI analyzed endoscopic data. YS, HT, TK, CT, YA, AN and SMperformed the histological examination of the organs. YS, MI and ... cases of duodenal solitary Peutz-Jegherstype hamartomatous polyp. Case 1 was a hamartoma-tous polyp with a focus of well-differentiated adenocar-cinoma, and Case 2 was a hamartomatous polyp ... of cancer in the gastrointestinal tract has been reported in 20-25% of patients with PJS, and a risk of cancer in other organs has been also reported, including the ovary, breast, bladder, pancreas...
- 4
- 458
- 0
Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx
... Karin M: The two NF-kappaB activation pathways and theirrole in innate and adaptive immunity. Trends Immunol 2004, 25:280-288.2. Silverman N, Maniatis T: NF-kappaB signaling pathways in mammalian and ... AnalysisAll graphs and statistical analyses were produced usingPrism software (GraphPad Software Inc., La Jolla CA).ResultsTMP acts early to inhibit synthesis of TNF -a and MCP-1/CCL2 mRNAsWe have ... to inhibit the binding of RelA to the promoters of certain key pro-inflammatorycytokine and chemokine genes. Taken together our datasuggest that TMP could be useful for the treatment of inflammatory...
- 11
- 622
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyentài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ