Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt
Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx
... TAMRA rat caIII probe: cttcaccacgccaccctgcgag5¢ rat gapdh: gggcagcccagaacatca3¢ rat gapdh: ccgttcagctctgggatgac5¢ 6-FAM, 3¢ TAMRA rat gapdh probe: ccctgcatccactggtgctgccPreparation of total ... knockdown of caIIImRNA and protein and enhanced caspase 3 catalyticactivity in Rat1 cells.Fig. S2. DsiRNA-mediated knockdown of caIIImRNA and protein and caspase 3 catalytic activity in Rat1 cells ... by at least one of these agents (taxol) and therefore probably also actsas a survival factor in these cells. Evi1-mediated pro-tection from taxol-induced apoptosis in rat intestinalepithelial...
- 12
- 446
- 0
Báo cáo khoa học: "Growth, gas exchange and carbon isotope discrimination in young Prunus avium trees growing with or without individual lateral shelters" doc
... Gas exchange parameters were calculatedon a leaf area basis. Leaf area was determined in situ just prior to the gas exchange measure-ments by means of a portable area ... unit area (LMA, ra-tio of leaf mass to leaf area). Relative carbon isotope composition (δp) of the leaves was higher in treatment C than in treatments L and ... found a negative correlation be-tween leaf Δ and the daily integrated values of leaf incident Ip in a Panamanian C3 epi-phytic orchid, Casatetum viridiflavum,...
- 10
- 369
- 0
Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx
... malignant mixed tumors of the salivary glands, carcinoma ex mixed tumors, carcinosarcomas, and metastatic mixed tumors with a benign appearance [3]. Nearly 99% of malignant mixed tumors are carcinoma ... Radiographic images of the head showing a large tissue-dense mass (A) with faint circular calcific opacity (B).Malignant mixed tumor in the salivary gland of a catHeejaung Kim1,2, Munekazu Nakaichi3,*, ... mixed tumor, salivary gland Salivary gland tumors are rare in dogs and cats, with a reported overall incidence of 0.17% [1]. Most cases are reported in older patients and generally affect the...
- 3
- 302
- 0
Báo cáo khoa học: "Malignant ocular melanoma in a dog" pptx
... ...
- 2
- 272
- 0
Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"
... time of day and the incidence of crisis recognition in hospitals. Their review of over 2000 events revealed an increase in events at certaintimes of the day, notably near nursing handoffs and ... forHealthcare Improvement and the Society for Critical CareMedicine have been promoting rapid response teams andMETs. In North America and in Europe, there now appears tobe a rapid increase in ... developing a medical crisis requiring a MET if no action is taken to prevent it. On the other hand, the MET patient may be instead a symptom of a hospital in crisis. In other words, the MET patient...
- 2
- 441
- 0
Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf
... MMPs are secreted as inactive proenzymes andlatency is maintained by an interaction between a cystein residue in the prodomain and Zn2+ in the active site of the catalytic domain. Two major ... 5275protein in the two cell lines was determined asdescribed in Materials and methods, and 81 lg of pro-tein was added to each well. The amount of S10 0A4 in the II-11b cells was 1.2% of that in the ... MT1-MMP catalytic domain in the presence of increas-ing concentrations of TIMP-1 as described in Materials andmethods and analysed by gelatin zymography. As controls, the proMMP-2 alone was either...
- 12
- 572
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... [9].Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 random-ized oligonucleotides in the center, i.e. CTGTCAGTGATGCATATGAACGAATN10AATCAACGACATTAGGATCCTTAGC was synthesized. ... competitionassay were the same as used in the quantitative DNA-bind-ing assay described above. The radioisotope-labelled DNAprobe was first mixed with the binding protein at a concen-tration corresponding ... recognition of these bases was the individualfeature of distinct AtERFs binding to the DRE motif. In vivo DNA binding specificity of AtERFs by the reporter–effector transient assayTo confirm if these binding...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc
... lucigenin (SigmaChemical Co.) in HBSS into the stainless cell of the system. The area under the curve was calculated to obtain totalchemiluminescence.Statistical analysis The animals were maintained ... response to the superna-tant fluids of SEC1-stimulated PBMC in rabbits was in parallel with the levels of interleukin-1b and interleukin-6 in the supernatants. The release of interleukin-1b and interleukin-6, ... mice. J Appl Physiol92, 2648–2655.51 Yamamoto Y & Gaynor RB (2001) Therapeutic poten-tial of inhibition of the NF-kappaB pathway in the treatment of in ammation and cancer. J Clin Invest...
- 13
- 465
- 0
Tài liệu Báo cáo khoa học: Various secretory phospholipase A2 enzymes are expressed in rheumatoid arthritis and augment prostaglandin production in cultured synovial cells docx
... (C–E) Staining of sPLA2-V in three active RA tissues. In all cases, intense staining of the granulation tissue in the sublining interstitium was evident. Staining of the granulation tissue and ... Administration of PGE2into the hindpaws of rats with adjuvant arthritis (a rat model of RA) exacerbates edema [49], and gene targeting of enzymes involved in the biosynthesis of PGE2, inclu-ding cPLA2 a ... expressed in synovial lining cells in the sectionfrom a patient with active RA (Fig. 2B,C). Staining of the synovial sublining area was also significant, andthere was scattered expression in mononuclear...
- 18
- 432
- 0
Tài liệu Báo cáo khoa học: "Wikipedia as Sense Inventory to Improve Diversity in Web Search Results" doc
... want to considerapproaches that involve a manual creation of train-ing material, because they can’t be used in prac-tice.Given a Web page p returned by the searchengine for the query w, and ... listed in the Wikipedia dis-ambiguation page.We have also experimented with a variant of the approach that uses our estimation of sense fre-quencies, similarly to what we did with the VSMapproach. ... Wikipedia en-tries for camel which are not in WordNet, for in- stance, include the Apache Camel routing and me-diation engine, the British rock band, the brand of cigarettes, the river in Cornwall,...
- 10
- 526
- 1
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ