Báo cáo khoa học: "Crown architecture in relation to productivity of Populus clones in the Pacific Northwest, U S A " ppt

Báo cáo khoa học: "Crown architecture in relation to productivity of Populus clones in the Pacific Northwest, U.S.A." ppt

... proleptic and sylleptic branches. Leafareas of large, representative samples weremeasured with a Lambda (LiCor Inc., U. S. A. )leaf area meter.Results and DiscussionSignificant ... BelgiurrMaterials and MethodsTwelve different Populus clones were grown at a 1 x 1 m spacing in a 0.36 ha plantation, esta-blished in February 1985 at Puyallup, Washing-ton ... interception and leafarea of the same clones has been de-scribed elsewhere in this volume by Sca-rascia-Mugnozza et al. (1989).* Please address all correspondence to Antwerp,...

Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc

... with the Biorad Protein Assay Kit (Biorad,Hercules, CA, USA) and BSA as a standard.Determination of the equilibrium constantsby ELISA The dissociation constants at equilibrium in solution, ... towards this virus to the exclusion of other ﬂavi-viruses, the cross-reactivities towards the four viralserotypes, and the mechanisms of neutralization at a molecular level. The diversity of the ... antiparallelb-strands can give rise to a dipolar interaction (nOe). A comparison of the NOESY spectra of MalE-E3-H6and MalE allowed us to unambiguously assign fourinterstrand H a -H a nOe signals to the E3...

Báo cáo khoa học "ADIABATIC TEMPERATURE RISE AND REACTION RATE OF MASS STRUCTURE IN LOTTE CENTER HANOI PROJECT " pptx

... reducing internal restraining stress through finite analysis. As a result, a thermal crack index is over 1.0 and a curing time of mass-section foundation decreases within 18 days through minimizing ... analysis of the total cross section of mat foundation (b) Stress dispersion of the total cross section of mat foundation during and after curing (c) TCI of the total cross section of mat ... with mass section to have a rational crack control plan based on analysis of thermal stress from hydration heat. Because mass concrete can cause crack to deteriorate durability of structure. So,...

Báo cáo khóa học: O-acetylation and de-O-acetylation of sialic acids in human colorectal carcinoma docx

... proportion of individual sialic acids is expressed as a percentage of the total sialic acid in each sample. Values stated in parenthesis are lg sialic acidÆmg protein–1.HPLCanalyses;n¼ 13 (values are ... Mucin degradation in the human colon: pro-duction of sialidase, sialate O-acetylesterase, N-acetylneuraminatelyase, arylesterase, and glycosulfatase activities by strains of fecalbacteria. ... activity in different subcellular fractions preparedfrom carcinoma and resection margin mucosa was assayedusing a number of different substrates. Nonspeciﬁc esteraseassays were performed using the...

Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

... andNS 4A cofactor fused to the N-terminus(green) (PDB: 1CU1) [7]. The structural zincatom in the protease domain and a phos-phate group in the helicase domain are alsovisible. The interface ... substrate,Ac-Asp-Glu-Asp(EDANS)-Glu- Glu-Abu-w-[COO]Al a- Ser-Lys(DABCYL)-NH2(AnaSpec, San Jose, CA, USA), wasrecorded continuously over time with a ﬂuorescence platereader (Fluoroskan Ascent ... also that minordifferences in the nature of the introduced side chain in uenced the charac-teristics of the enzyme. These results indicate that residues in the helicasedomain of nonstructural...

Báo cáo khoa học: "Learning Noun Phrase Anaphoricity to Improve Coreference Resolution: Issues in Representation and Optimization" ppt

... :=cost of misclassifying a positive instancecost of misclassifying a negative instanceInspection of this definition shows that cr provides a means of adjusting the relative misclassificationpenalties ... single NP and consists of a set of features that are potentially useful for dis-tinguishing anaphoric and non-anaphoric NPs. The classification associated with a training instance —one of ANAPHORIC ... incorporated into the coreferencesystem as a feature rather than as constraints.Specifically, each training/test instance i(NPi,N Pj)is augmented with a feature whose value is the computed anaphoricity...

Báo cáo khoa học: "Collaborative control initiatives targeting zoonotic agents of alveolar echinococcosis in the northern hemisphere" ppsx

... system of continuous surveillance and risk assessment, and that these measures be combined with measures to reduce illness and death that occurs as a result of alveolar echino-coccosis in ... anthelmintic baiting of foxes against urban contamination with E. mutilocularis using intravital diagnosis for the assessment of efficacy was highly successful in Switzerland [14]. In the Swiss ... diagnosis was used. Taken together, these results indicate that the use of intra-vital diagnosis, such as coproantigen [1] or copro-DNA [26] examination provides a superior means for assessing...

báo cáo khoa học: "Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma?" pptx

... implants. Pathological examination of the surgical specimen indicated no residual adenocarcinoma but scar on lesser curvature with fibrosis extending into muscularis propria (Figure 2). There ... dissections, Roux-en-Y esophagojejunostomygastric surgery was practiced in August 2010. Prior to surgical resection, laparoscopy revealed no evidence of peritoneal carcinomatosis or metastatic ... Most important advice (to eat small, frequent meals) following a gastrectomy was proposed .Oral Capecitabine was substituted by intravenous perfusion of 5FU for 96 hours. Last cycle of treatment...

báo cáo khoa học: " TILLING for allergen reduction and improvement of quality traits in peanut (Arachis hypogaea L.)" pdf

... CGATTTACTCATGTACAATTAACAATAGAT816 5’ Ara h 2.02 ATCACCTTAAATTTATACATATTTTCGG371 3’ Ara h 2 CAGCAACAAAACATAGACAACGCC1306 5’ Ara h 1 GAGCAATGAGAGGGAGGGTT1307 3’ Ara h 1 CCTCCTTGGTTTTCCTCCTC1308 3’ Ara ... and could be used to assist in the modification of other traits such as disease resis-tance, stress tolerance, early maturity, or as shown in thisstudy, nutritional properties of the seed.MethodsSouthern ... 0.1% SDS. The blot was visualized by exposure to a Storage Phos-phor Screen (Amersham Biosciences, Piscataway, NJ)which was then scanne d using a Storm 840 imagingsystem (Amersham Biosciences).Mutant...

báo cáo khoa học: "Transcriptome analysis by GeneTrail revealed regulation of functional categories in response to alterations of iron homeostasis in Arabidopsis thaliana" pdf

... functional categories in large-scale plant transcriptome data sets. The distinguishedfeature that allowed analysis of individually assembled functional categories facilitated the study of the Arabidopsisthaliana ... analysis methods, GSEA and ORA, togetherwith other analysis tools, like the NIA array tool, wassuccessfully applied for data mining. The main strength of GeneTrail was that it offered answers to ... developedby the National Institute on Aging [21] was utilized. The statistical analysis performed with this online toolwas based on the single-factor ANalysis Of VAriance(ANOVA). The statistical significance...

Xem thêm