báo cáo khoa học: "Pulmonary sclerosing hemangioma in a 21-year-old male with metastatic hereditary non-polyposis colorectal cancer: Report of a case" pps

... sweats. Physical examination wasunremarkable. Carcinoembryonic antigen (CEA) andcarbohydrate antigen 19-9 (CA 19-9) were within nor-mal range. Clinical staging diagnostics revealed a par-tially ... 9:62http://www.wjso.com/content/9/1/62Page 3 of 6CAS E REP O R T Open AccessPulmonary sclerosing hemangioma in a 21-year-old male with metastatic hereditary non-polyposis colorectal cancer: Report of a caseTobias S Schiergens1*†, ... andpolygonal cells in pulmonary sclerosing hemangioma. Hum Pathol 2004,35:503-508.5. Satoh Y, Tsuchiya E, Weng SY, Kitagawa T, Matsubara T, Nakagawa K, et al:Pulmonary sclerosing hemangioma of the...

Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identiﬁcation of three genotypes that differ in copy number and steroidogenic output pptx

... K, Yasuda K, Yanase T, Yamakita N, SasanoH, Nawata H, Inoue M, Fukaya T & Shizuta Y (1996)Mutation of cytochrome P-4501 7a gene (CYP17) in a Japanese patient previously reported as having ... same flock. Each group of 10 containedfive ewes and five rams. The animals were all born duringthe same kidding season, and were approximately 14 months of age. A single dose of insulin (Humalin ... (antisense)GAGGCAGAGGTCACAGTAATCYP17 sensorprobeTTCTGAGCAAGGAAATTCTGTTAGAC-FLCYP17 anchorprobe640-TATTCCCTGCGCTGAAGGTGAGGA-pReal-time 3bHSDLP (sense)CTGCAAGTTCTCCAGAGTCReal-time 3bHSDRP (antisense)ATTGGACTGAGCAGGAAGCTwo...

Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

... statistical machine translation. In Proceed-ings of AMTA.Sylvain Raybaud, Caroline Lavecchia, David Langlois,and Kamel Sma¨ıli. 2009. New conﬁdence measuresfor statistical machine translation. ... 2007. Large language mod-els in machine translation. In Proceedings of the2007 Joint Conference on Empirical Methods in Nat-ural Language Processing and Computational Natu-ral Language Learning ... Computational Linguis-tics.Franz Josef Och. 2003. Minimum error rate training in statistical machine translation. In Proceedings of the41st Annual Meeting of the Association for Compu-tational...

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

... used togenerate the mutations were (positions of mismatchesunderlined): F14 4A: 5¢-CAA AAT GGGGCT GAC AACTCC-3¢; F144Y: 5¢-CAA AAT GGGTAT GAC AACTCC-3¢; F22 9A: 5¢-CAC GAT GCTGCC CAA GTCTTT-3¢; ... subfamilies [15]. The stacking of aromatic residues against the hydrophobic faces of sugar rings is a recurring feature of protein–carbohy-drate interactions [16] and is a critical element of ... using BSA as standard and by Nano-drop spectroscopy (NanoDrop, Wilmington, DE, USA).Enzyme activity analysisGlycoside hydrolase activity of the Exg mutants was deter-mined with laminarin, a...

Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf

... is a pool of three target-speciﬁc 19–25 nucleo-tide siRNAs with the following sequences:360 CAGCTTCCTCGTATCTACATTCAAGAGATGTAGATACGAGGAAGCTGTTTTT;1179CCATTCTGCCGTATATTGATTCAAGAGATCAATATACGGCAGAATGGTTTTT;1624CTCAGAGATTGCCCTTTCTTTCAAGAGAAGAAAGGGCAATCTCTGAGTTTTT.The ... (Burlington, Canada). Ethanol wasobtained from the Pharmaceutical Services of the HealthSciences Centre (Winnipeg, Canada). Anti-actin serum (A5 441), MTT, ATP bioluminescent assay kit (FL-AA) andall ... theintensity of the individual proteins.Determination of mRNA expressionPHB and actin gene expression was also determined byreal-time PCR, using as primers: PHB: 5¢-GATTTACAGACAGTGGTGCACACA-3¢...

Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt

... studies. With regard todepression, Boylan et al [30] reported that 50% of inpa-Table 4: Simple linear regression analyses of factors associated with STAI-S95% Confidence intervalFactor Unstandardized ... board.All participants were previously subjected to a thoroughclinical and laboratory investigation, including electroen-cephalogram (EEG) and high-resolution brain magneticresonance imaging ... model accounted for 10.4% of thevariation of the STAI-S (R2 = 0.108).The associations of levels of anxiety quantified using STAI-T index with demographic and clinical characteristics arepresented...

Báo cáo khoa học: " Accelerated high-dose radiotherapy alone or combined with either concomitant or sequential chemotherapy; treatments of choice in patients with Non-Small Cell Lung Cancer" pps

... Schuster-Uitterhoeve AL, Vaart , Schaake-Koning CC, Benraadt J,Koolen MG, Gonzalez GD, Bartelink H: Feasibility of escalatingdaily doses of cisplatin in combination with accelerated radi-otherapy in non-small ... A randomised phase III study of accel-erated or standard fraction radiotherapy with or withoutconcurrent carboplatin in inoperable non-small cell lung can-cer: final report of an Australian ... cause of cancer related-death with an increasing inci-dence each year. The majority of patients has Non-SmallCell Lung Cancer (NSCLC) and 75% has advanced diseaseat the time of diagnosis. Since...

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... understand-ing provides insight into potential errors (bias andrandom error) related to data based on clinical examina-Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36Page ... central to minimizingvariation and bias, regardless of the later use of the datafor quantitative analyses. Definitions of accuracy and pre-cision here are defined in accordance with Dohoo et al.[11]. ... or her evaluation of the localcontext. That is, treatment data as an indicator of a certaindisease manifestation may only be valid within the herd.When veterinarians used standard treatment...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... Puriﬁcation and characterization of a transmembrane domain-deleted form of lecithinretinol acyltransferase. Biochemistry 42, 6090–6098.45 Muniz A, Villazana-Espinoza ET, Thackeray B & TsinAT ... High magniﬁcationimages of the boxed area in (B4) showing RPE65c staining (B5), GS staining (B6), merged RPE65c and GS staining (B7), and DAPI staining(B8), respectively. White arrows indicate...

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... decreases of dopamine transporter in combination with monoamineoxidase inhibition appear to have thepotential of efﬁciently increasingextracellular dopamine levels at thesame time as minimizing ... level is a key regulator of the rate of mitochondrialrespiration in the heart allowing ATPand creatine phosphate levels tomaintain relatively constant over a large range of cardiac work rateODE ... clear that thecommercial software matlab (MathWorks, Natick,MA, USA; www.mathworks.com) is the dominatingsoftware (Fig. 8). Additional commercial softwarepackages that are widely used are mathematica...

Xem thêm