báo cáo khoa học: "Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy is recommended" ppt

... this article as: Emori et al.: Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbro nchial biopsy is ... SURGICAL ONCOLOGY Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy is recommendedEmori ... Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka 537-8511, Japan.2Department of Radiology,Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka 537-8511, Japan.3Department...

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... agammaglobulin-emia. A clinical and molecular analysis. Medicine(Baltimore) 75, 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini R, De Mattia D,Dell’Erba G ... Tsukada S, Saffran DC, Rawlings DJ, Parolini O, AllenRC, Klisak I, Sparkes RS, Kubagawa H, Mohandas T,Quan S et al. (1993) Deﬁcient expression of a B cellcytoplasmic tyrosine kinase in human ... in terms of transformation capacity, membrane localization and phosphorylation of key residues?Comparison between the activation of ITK–SYK and BTK–SYKTo determine its activation capacity, we...

Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

... centrifugation through an oilcushion and dissolved prior to determination of theamount of dyes associated with them. The advantages of such an assay are that: (a) it is quantitative; (b) it is not affected ... Doyle LA, Yang W, Abruzzo LV, Krogmann T, GaoY, Rishi AK & Ross DD (1998) A multidrug resistancetransporter from human MCF-7 breast cancer cells[Published erratum appears in Proc Natl Acad ... extracellularsurface of the plasma membrane. Because the surfacearea of intracellular membranes far exceeds that of theplasma membrane, it is expected that, upon true equili-bration of dyes...

Báo cáo khoa học: Human telomeric G-quadruplex: thermodynamic and kinetic studies of telomeric quadruplex stability potx

... quadruplex folding and unfolding reac-tions, with the signiﬁcant advantage that enthalpychanges can be monitored directly and data obtainedin a model-free fashion [36,37]. Disadvantages of ... and stability. In QuadruplexNucleic Acids (Neidle S & Balasubramanian S, eds),pp. 100–130. Royal Society of Chemistry, Cambridge.67 Nakatani K, Hagihara S, Sando S, Sakamoto S,Yamaguchi ... results are bothdisturbing and discouraging. There is an unacceptably wide range in the values reported from different labo-ratories. Reported Tmvalues range from 56 to 63.7 °Cin 100 mm Na+and...

Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx

... °CCACCTCGAGTTATTATAGCTCAAACACCATCC44/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 3 min/72 °CCACCTCGAGTTATTATAGCTCAAACACCATCC44/750_V5-His AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... min/72 °CAAACTCGAGTTATTATTCAATATCAAACAGAG59/750 AAAAGATCTAAAGCATTTTTGGATGAATTG 1 min/94 °C; 1 min/54 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG90/750 AAAAGATCTTTTCAGCTTGCAAAGCAA 1 min/94 °C; ... min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG274/750 ACACTCGAGAGATCTGCAAATGAATATG 30 s/94 °C; 1 min/57 °C; 4 min/72 °CATTCTCGAGTCATTAGGCTACTTCACTCAAAG274/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30...

Báo cáo khoa học: Residues affecting the chloride regulation and substrate selectivity of the angiotensin-converting enzymes (ACE and ACE2) identiﬁed by site-directed mutagenesis pot

... mM(filled bars) NaCl. (A) Cleavage of angiotensin I by tACE variants. (B)Cleavage of angiotensin I by ACE2 variants. (C) Cleavage of angio-tensin II by ACE2 variants. Generation of product was determinedby ... that thisvariant has a threefold greater catalytic efficiency thanthe wild-type with angiotensin II, and this is not a result of an alteration in substrate-binding affinity but of an increase ... interactionWTR186QW27 9A R489QR522QR186QR489QR522QMocktACE variantsAB100 kDaWTR169QW27 1A K481QR514QR169QK481QR514QMock←ACE2←tACE150 kDaACE2 variants100 kDa150 kDaFig. 2. Expression of wild-type and mutant variants of tACE and ACE2....

Báo cáo khoa học: Puriﬁcation, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt

... cellotetraoseFig. 1. SDS/PAGE analysis of the puriﬁed cellulase from larval gutjuice of P. hilaris . Lane 1, molecular mass standards consisting of myosin (200 kDa), b-galactosidase (116 kDa), phosphorylase ... G., Saito, H. & Watanabe, H. (2002) A digestive beta-glucosidase from the salivary glands of the termite, Neotermeskoshunensis (Shiraki): distribution, characterization and isolation of its ... cellotetraose and cellopentaose)were analyzed by TLC.Electrophoresis and activity stainingSDS/PAGE was performed as described by Laemmli [11], and native PAGE was carried out in the same way exceptthat...

Báo cáo khoa học: Structural insight into the evolutionary and pharmacologic homology of glutamate carboxypeptidases II and III ppt

... (such as macaque,mouse and rat). Ramachandran analysis of the ﬁnalmodels classiﬁes all residues but two, Lys197 and Asn168 (in the GCPIII ⁄ ‘pseudo-unliganded’ complexonly), as having either favorable ... struc-tural domains, which are analogous to the threedomains of GCPII [27]: a protease domain (aminoacids 46–106 and 342–580), an apical domain (aminoacids 107–341) and a helical domain (amino acids ... species, such as in orangutan and macaque. In this respect, it is interesting to note thatthe Ramachandran angles for the Gly548 residue of GCPII are highly unfavorable for any l-amino acid.The...

Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

... Beach D & Yablonski D (2007)SLP-76 mediates and maintains activation of the Tecfamily kinase ITK via the T cell antigen receptor-induced association between SLP-76 and ITK. ProcNatl Acad ... 111–119.23 Townsend M, Weinmann A, Matsuda J, Salomon R,Farnham P, Biron C, Gapin L & Glimcher L (2004)T-bet regulates the terminal maturation and homeostasis of NK and Valpha14i NKT cells. Immunity20, ... devel-opment at the initial stages of maturation [28], and both mice deﬁcient in Itk and those that express a transgene for PLZF have a developmental block instage 2 of iNKT cell maturation, all of which...

Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx

... observed by the veterinarian and/ or farmerwithin 4 weeks postpartum. Abomasal displacement wasdiagnosed by a pinging sound upon abdominal auscultationby a veterinarian, and all cases were corrected ... present: an ovarian structure of greater than 25 mm internal diameterwith a wall less than 3 mm thick (follicular cyst) and with a wall more than 3 mm thick (luteal cyst) in the absence of a normal ... on development of retained placenta of abnormalpartus (total cases of dystocia, caesarean section, twins and stillbirth), parity, gestation length, and calving season, weused logistic regression...

Xem thêm