Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer " pps
Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx
... 6:6http://www.ethnobiomed.com/content/6/1/6Page 6 of 8 The Garasiya tribe The Garasiya people are main inhabitant of surround-ings areas of the Mount Abu wildlife sanctuary, Pind-wara and Aburoad tehsil of Sirohi district of Rajasthan.Earlier ... animal origin by Garasiya people of Rajasthan.Methods The study area The Mount Abu wildlife sanctuary is located in the Southwestern Rajasthan close to the border of Gujaratstate of India, in ... is also one of them, and thus the aim of this work was to take an ethnozoological fieldsurvey among Garasiya people (main tribal group of this area) in the adjoining areas of this sanctuary.Method:...
- 8
- 550
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
... concen-tration at the cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustainedavailability of IL-1Ra that this method permits.Materials and methodMaterialsHam’s ... potential of this mater-ial. Gene delivery may offer the greatest chance of earlysuccess. Recent data from our laboratory have shown that the synovial lining is capable of maintaining therapeuticlevels ... apparent, as were the advantages of gene transfer as a means of protein delivery. In the face of continual dilution, the con-stitutive production of the IL-1Ra gene product was ableto maintain...
- 9
- 421
- 0
Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx
... bone marrow cells and a three-dimensional scaffoldKoji Hattori1, Yoshinori Takakura1, Hajime Ohgushi2, Takashi Habata1, Kota Uematsu1, Jun Yamauchi1, Kenji Yamashita3, Takashi ... Masao Sato3 and Ken Ikeuchi41Department of Orthopaedic Surgery, Nara Medical University, Nara, Japan2National Institute of Advanced Industrial Science and Technology, Amagasaki Site, Hyogo, ... by wavelet transformation. On the wavelet map, the percentagemaximum magnitude (the maximum magnitude of the measurement area of the operated knee divided by that of the intact cartilage of the opposite,...
- 8
- 355
- 0
Báo cáo y học: "An MRI study on the relations between muscle atrophy, shoulder function and glenohumeral deformity in shoulders of children with obstetric brachial plexus injury" ppt
... form was related to infraspinatusmuscle atrophy. Subluxation was related to both infraspinatus and subscapularis atrophy. Therewas no relation between atrophy of muscles and passive external ... anterior part of this line (AB) wasdivided by its total length (AC) and multiplied by 100. The normal value for this variable is approximately50%[6]StatisticsAll data were collected and analysed ... glenoid)was used to measure the percentage of humeral head ante-rior to the middle of the glenoid fossa. The largest diame-ter of the humeral head was measured perpendicular tothis line (AC). The anterior...
- 8
- 433
- 1
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
... portion of yuccaols A and B andtrans-3,3',5,5'-tetrahydroxy-4'-methoxystilbene is the stil-bene in yuccaols C, D and E. By the analogy to the biosyn-thesis of larixinol it was presumed ... extraction. The chemistry and bioactivity of yucca saponins and phe-nolics have recently been reviewed by Piacente et al. [21].Anti-arthritic effects of yuccaYucca products have been used for many years ... causation of arthritis hasany merit, a role of yucca in arthritis treatment can beadvanced on the basis of the anti-protozoal activity of yucca saponins.Representative blot of iNOS expression (a) ....
- 7
- 369
- 0
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx
... (iPsbW and sPsbW).For iPsbW, the forward and reverse primers were ATGGGTAAGAAGAAGGGAGGA and TCTCTTTGCTCGGACGCG, respectively. For sPsbW, the forward and reverseprimers were ATGGAGACAAAGCAAGGAAAC ... PsbY -A1 , the hydrophobicity of the C-domain is critical for correct maturation and negativecharges in particular appear to be favored. In the case of PsbY -A2 , the negative charge in the translocated ... near the A2 processing site blockscleavage of the A1 signal peptide. (A) PsbY -A2 /VV was imported intochloroplasts and the organelles were fractionated and analyzed as detailed in Fig. 8A. Lane...
- 11
- 484
- 0
Báo cáo y học: "Can physical activity improve the mental health of older adults" pps
... cancers.Delaying the clinical onset of AD by two years wouldreduce the total number of AD cases by approximately600,000 in the USA alone [5]. Physical activity (PA) isoften seen as an intervention ... months, particularly if theyremain physically active during the follow-up period [32].Finally, the results from the Almada County Study showed that physical activity was associated withdecreased ... Physical activity and quality of life in older adults The large body of research in this area clearly demon-strates that a major aim of PA programs is not just decreas-ing mortality, but also...
- 5
- 544
- 0
Báo cáo y học: "Put your heart into the joint benefits of statins" pps
... Therapy Vol 5 No 4 Hall The recognition that systemic inflammatory diseases areassociated with accelerated atherosclerosis offers the prospect of reducing morbidity and mortality of affectedpatients ... it was reported that pravastatin decreased the incidence of haemodynamically significant rejectionepisodes in cardiac transplant patients and that this effectwas independent of the decrease ... of immune/inflammatory responses. The appeal of statintherapy in chronic inflammatory disease is furtherenhanced by accumulating evidence that statins mightinfluence bone metabolism (reviewed by Bauer...
- 3
- 298
- 0
Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf
... GeneChips and one was measured by two-channel cDNAarrays (see Materials and methods for details about thesedatasets). For each dataset, we calculated the RE-scores of each miRNA in all samples. ... com-puted the Spearman correlation of the RE-scores and the ARR values for each microarray dataset. As illustrated inTable 2, the inhibitory activities calculated by these two dif-ferent methods are ... pathways comprise a major cascade in ER- cancers[68]. Type I interferon signals can be transduced by the MAPK pathway [71], and the activated MAPK pathway in ER-cancers may enhance the signal...
- 17
- 259
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ