Báo cáo y học: " Adding 5-hydroxytryptamine receptor type 3 antagonists may reduce drug-induced nausea in poor insight obsessive-compulsive patients taking off-label doses of selective serotonin reuptake inhibitors: a 52-week follow-up case report" potx
Báo cáo y học: " Adding 5-hydroxytryptamine receptor type 3 antagonists may reduce drug-induced nausea in poor insight obsessive-compulsive patients taking off-label doses of selective serotonin reuptake inhibitors: a 52-week follow-up case report" potx
... Access Adding 5-hydroxytryptamine receptor type 3 antagonists may reduce drug-induced nausea in poor insight obsessive-compulsive patients taking off-label doses of selective serotonin reuptake inhibitors: ... 2007, 16 :35 1 -35 4.doi:10.1186/1744-859X-9 -39 Cite this article as: Fornaro and Martino: Adding 5-hydroxytryptamine receptor type 3 antagonists may reduce drug-induced nausea in poor insight obsessive-compulsive ... fluoxetine plus 30 mg/daymirtazapine and 10 mg/day olanzapine.Fornaro and Martino Annals of General Psychiatry 2010, 9 :39 http://www.annals-general-psychiatry.com/content/9/1 /39 Page 3 of 4 CASE REPO...
- 4
- 313
- 0
Báo cáo y học: "Vitamin D receptor gene polymorphisms and susceptibility of hand osteoarthritis in Finnish wome" pdf
... subject had at least three finger joints with radiographicOA of grade 2–4, she was classified as having finger OA.Symmetrical OA was defined as a subcategory of OA in atleast two symmetrical pairs ... joint, proximal interphalan-geal (PIP) joint, thumb interphalangeal joint, and metacar-pophalangeal (MCP) joint of both hands was gradedseparately, and was classified for the presence of OA ... the interaction with dietary calciumintake. A joint effect of a low calcium intake and carriage of theVDR aT haplotype on risk of symmetrical OA exceeded theiradditive effects, indicating that...
- 9
- 613
- 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... detection of circulatingAng-1 and Ang-2 in critically ill patients [27]. Despite thegrowing body of evidence indicating a role for Ang-2 as a mediator in critically illness, the value of Ang-2 as a ... II [32 ] andSOFA scores [33 ], were obtained at the time of enrollment.Detailed patients& apos; characteristics, including demographic, clin-ical and laboratory parameters, are shown in Table ... study [22], Ang-2 correlated with mortality in a univariate analysis. In a surgicalpopulation with ARDS, Ang-2 predicted death with a similardiscriminatory ability as the APACHE II score [ 23] ....
- 9
- 634
- 0
Báo cáo khoa học: An a-proteobacterial type malate dehydrogenase may complement LDH function in Plasmodium falciparum Cloning and biochemical characterization of the enzyme potx
... LDH: forward5¢-ATGGCACCAAAAGCAAAAATCG -3 and reverse5¢-AGCTAATGCCTTCATTCTCTTAG -3 ; Pf MQO for-ward 5¢-ATGATATGTGTTAAAAATATTTTG -3 andreverse 5¢-TCATAAATAATTAACGGGATATTCG -3 ).Both PCR and RT-PCR ... the enzymes was check ed by (A) a nalysis of equal amounts of RNAbyNorthernblottingandalsoby(B)analysisofequalamounts of proteins by Western blotting. G25 and G100 indicate the P. falciparumcultures ... haemoglobin bymalaria parasite during intraerythrocytic proliferationmakes it h ighly vulnerable to oxidative dam age [1]. Toavoid this oxidative damage, the parasite maintains a lowlevel of oxygen...
- 15
- 508
- 0
Báo cáo y học: "A 64-week, multicenter, open-label study of aripiprazole effectiveness in the management of patients with schizophrenia or schizoaffective disorder in a general psychiatric outpatient setting" pptx
... patients. Schizophrenia Trial of Aripiprazole: (STAR) study. Eur Psychiatry 2007,22: 433 -4 43. 26. American Diabetes Association; American Psychiatric Association; AmericanAssociation of Clinical Endocrinologists; ... ith typical antipsychoticagents [3] .Aripiprazole is a novel atypical antipsychotic withpotent partial dopamine receptor D2and D 3 agonistactivity [4,5], serotonergic 5-hydroxytryptamine ... (5-HT) 2A antagonist activity [6] and 5-HT 1A partial agonistactivity [7,8]. In addition, aripiprazole has minimal affi-nity for a2 adrenergic receptors, H1histamine receptorsand muscarinic...
- 9
- 748
- 0
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx
... calculated from the linear part of a standard curve. In contrast to other analyses, only86 SLE patients were analyzed regarding APP. A sandwich ELISA (Amersham Pharmacia Biotech, LittleChalfont, ... classification of SLE [31 ]. The 96females and 18 males, 17–75 years old (mean age ± stan-dard deviation, 40 ± 13 years), were all patients at theDepartments of Rheumatology at Sahlgrenska ... Temecula, CA, USA) and thebiotinylated monoclonal LN27 (Zymed, San Francisco, CA,USA). Capturing antibody 22C11, recognizing an epitopewithin amino acids 66–81 of the N-terminus of APP, wasused...
- 8
- 342
- 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... iscrucial for the generation of this signal, as cross-linking of GPVI in the absence of FcR c-chain was unable to promotean increase in phosphorylation of Syk. A transmembrane arginine residue and ... blotting as a band of 55 kDa.Additional bands of lower molecular mass are indicated. The associ-ated FcR c-chain was detected by Western blotting using a specificantibody. A sample of F1/c ... receptor- A in mast cellline by associating with subunits common to Fc receptors. J. Biol.Chem. 274, 30 288 30 296.7. Hayami, K., Fukuta, D., Nishikawa, Y. , Yamashita, Y. , Inui, M.,Ohyama, Y. , Hikida,...
- 10
- 506
- 0
Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx
... onphosphorylase phosphatase activity of yeast and mamma-lian PP2Ac poly-L-lysine was added to the purifiedenzymes. As presented in Fig. 5 a peak of poly-L-lysine-stimulated phosphorylase phosphatase ... necrosisfactor a (and some other pathways) and inactivation of phosphatase activity (reviewed in [24]). However no dataare available concerning phosphorylation of Tyr375 in S. cerevisiae. PP2Ac is also ... vs.2.5-fold activation of PP2Ac). PR65 /A subunit (3 nM)increased activation of PP2Ac by poly-L-lysine byapproximately 70% and it also increased stimulation of Pph22p by poly-L-lysine another...
- 11
- 447
- 0
Báo cáo Y học: The refolding of type II shikimate kinase from Erwinia chrysanthemi after denaturation in urea pot
... that the ordering of the strands 231 45 in the parallel b sheet places the enzyme in thesamestructuralfamilyastheNMPkinases(adenylatekinase, guanylate kinase, uridylate kinase and thymidinekinase).SK ... the absence of significant contaminant by nucleotide.Assay of enzyme activityThe activity of the shikimate kinase was determined by a double coupled assay involving pyruvate kinase (PK) andlactate ... Coyle, J.E., Horsburgh, M.J., Coggins, J.R. &Lapthorn, A. J. (1997) Crystallisation and preliminary X-raycrystallographic analysis of shikimate kinase from Erwiniachrysanthemi. Acta Crystallogr....
- 9
- 413
- 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
... D11– 13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTAGAGGATCTGACGAACTACTCTCAGGC -3 )andreverse primer R1 (5¢-ATTGGATCCTTATACACGAGAAGGAGCACC -3 ) to generate the pnPTB-NLD-I D11- 13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTCGACATGGACGGAATCGTCACT -3 ) ... consensus, and may be as long as 30 amino acids.Mammalian paralogs of importin a have recently beendiscovered and six genes for importin a have been found in human. The importin a that we have used in ... andfunctional domains, a short basic N-terminal importin bbinding (IBB) domain, and a large NLS-binding domaincomprising armadillo (Arm) repeats [17–19]. Crystal struc-tures of karyopherins a complexes...
- 8
- 1,064
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ