0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt

Báo cáo y học:

Báo cáo y học: "Binge eating symptomatology in overweight and obese patients with schizophrenia: a case control study" ppt

... suggest that binge eating symptomatology may play an important role in the initi-ation and maintenance of the WG phenomenon observed in at least part of patients with schizophrenia. Finally,management ... of binge eating symptomatology in patients treated with clozapine and olanzapine. J Neural Transm 2003,110:111-121.4. Aquila R, Emanuel M: Interventions for Weight Gain in AdultsTreated With ... Obesity, binge eating and psychopathol-ogy: are they related? Int J Eat Disord 1994, 15:53-61.10. Freeman LM, Gil KM: Daily stress, coping, and dietary restraint in binge eating. Int J Eat Disord...
  • 4
  • 331
  • 0
Báo cáo y học:

Báo cáo y học: "Osteogenic protein 1 in synovial fluid from patients with rheumatoid arthritis or osteoarthritis: relationship with disease and levels of hyaluronan and antigenic keratan sulfate" ppt

... Standard of keratan sulfate purifiedfrom human costal cartilage [20]. The intra-assay variation was<3%, and the inter-assay variation was <4%.Measurement of HA by ELISAHyaluronan in ... nonkeratan-sulfate-contain-ing rat chondrosarcoma proteoglycans that capture HA and the keratan-sulfate-bearing aggregating proteoglycans thatare subsequently added. The assay produces very similar val-ues ... HA levels in body fluids as five other immunoassays[24]. The reported intra-assay variation was <4%, and theinter-assay variation was <6%.Statistical analysisAll data were entered into...
  • 10
  • 406
  • 0
Báo cáo y học:

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3'siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3'siRNA4 ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3'siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3'T7...
  • 8
  • 576
  • 0
Báo cáo y học:

Báo cáo y học: ": Gastrointestinal relapse of multiple myeloma and sustained response to lenalidomide: a case repo" pps

... by a North American Institutioninvolved the gastrointestinal tract [3]. All of these caseshad a poor prognosis, with a maximal survival rate of 106days from diagnosis. Finally, Dawson et al. ... from TAM and PYD.TAM and XM reviewed and interpreted the pathology slides and CT scanimages, respectively. All authors read and approved the final manuscript.Competing interestsThe authors ... g/L after transplantation. In 2007, a second-line chemotherapy treatment(melphalan and prednisone, six cycles ) for a relapsecharacterized by diffuse spinal involvement and anincrease in monoclonal...
  • 3
  • 349
  • 0
Báo cáo y học:

Báo cáo y học: "Hepatotoxicity induced by horse ATG and reversed by rabbit ATG: a case report" ppsx

... M, Kishimoto Y, Nakai K, Shimizu T, Matsumoto N, Miyazaki Y, Yamamoto Y, Amakawa R, Fujimoto M, Fukuhara S: Antithymo-cyte globulin treatment in 11 patients with aplastic anaemia.Rinsho Ketsueki ... received androgen therapy. Afterfinding a healthy and an HLA identical sibling donor, thepatient was transferred to King Faisal Specialist Hospital and Research Centre (KFSH&RC) in Riyadh for allogeneicHSCT. ... Skvortsova YV, Dyshlevaja ZM, Samochatova EV, RumiantsevAG: Fludarabine, low-dose busulphan and antithmocyte glob-ulin as conditioning for Fanconi anemia patients receivingbone marrow transplantation...
  • 5
  • 459
  • 0
Báo cáo y học:

Báo cáo y học: " Primary hepatic lymphoma presenting as fulminant hepatic failure with hyperferritinemia: a case report" ppt

... hepatitis B, C and Epstein-Barr have beenimplicated. Signs and symptoms can mimic a variety ofinfectious and inflammatory disorders delaying the diag-nosis. A preliminary diagnosis of AOSD was ... weightloss, myalgias and arthralgias. She had mild epigastric dis-comfort with nausea and vomiting. Dalteparin and warfa-rin were started for a recently diagnosed pulmonaryPublished: 19 August 2008Journal ... around 25%.Chemotherapy is the main treatment modality althoughsurgery and radiotherapy have also been used. StandardCHOP chemotherapy can be challenging with severehepatic dysfunction, and...
  • 4
  • 269
  • 0
Báo cáo y học:

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

... Germany; 2. Max Planck Institute for Chemical Ecology, Dortmund, Germany Correspondence to: Francisco Castaneda, MD, Laboratory for Molecular Pathobiochemistry and Clinical Research, Max Planck ... Na+-glucose cotransporters, on metabolic index and insulin secretion in spontaneously diabetic GK rats. Clinical and Experimental Pharmacology and Physiol-ogy. 2002; 29: 386-390. 18. Tsujihara K, Hongu ... J Pharm Pharmacol. 2000; 52: 303-310. 28. Hirayama BA, Lostao MP, Panayotova-Heiermann M, et al. Kinetic and specificity differences between rat, human, and rab-bit Na+- glucose cotransporters...
  • 9
  • 650
  • 0
Báo cáo y học:

Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot

... 29]. Health professionals should encourage individuals of all ages to maintain an active life-style that can attenuate the negative physiologic changes that accompany advancing age, leading to ... Tratado de Geriatria e Gerontologia. Guanabara Koogan, 2002:496-501. 5. Kanaya AM, Harris T, Goodpaster BH, Tylavsky F, Cummings SR. Adipocytokines Attenuate the Association Between Visceral ... measures were obtained by a single trained examiner. Body mass, height and waist circumference were assessed. Body Mass Index was calculated for each subject. A 6-min walk test was administered...
  • 5
  • 426
  • 0
Báo cáo y học:

Báo cáo y học: "Hormone replacement therapy in rheumatoid arthritis is associated with lower serum levels of soluble IL-6 receptor and higher insulin-like growth factor 1" doc

... after 12 and 24 months, using vaginal ultrasonography and cytology. E2 in serum was measured (approximately 12 hours aftertablet intake) by radioimmunoassay (Clinical AssaysTM,DiaSorin, Vercelli, ... Kameda T, Mano H, Yuasa T, Mori Y, Miyazawa K, Shiokawa M,Nakamaru Y, Hiroi E, Hiura K, Kameda A, Yang NN, Hakeda Y, Kumegawa M: Estrogen inhibits bone resorption by directlyinducing apoptosis ... Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S,Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, KishimotoT, Suda T: Soluble interleukin-6 receptor triggers osteoclastformation by...
  • 8
  • 455
  • 0
Báo cáo y học:

Báo cáo y học: "High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis" potx

... annealing temperature. Theprimer pairs 5′-TGG GCA ACA ATA CAG CAA ACT-3′ and 5′-GAG CAG GAA GAT GAG GAC GAC-3′, at 58°Cannealing temperature and for 33 cycles, were used forCXCR2-specific amplification; ... to synovial fibroblasts,identified by an antibody against prolyl-4-hydroxylase (datanot shown). In 10 OA samples examined, there was stain-ing for CXCR1 protein on a few macrophages within ... diag-nosed more than 2500 synovial tissue samples of RA.DNA microarray analysis A global expression analysis of synovial tissue from patients suffering from RA and OA was performed usingAffymetrix GeneChip...
  • 12
  • 402
  • 0

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ