Báo cáo khoa học: " spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France)" ppt
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACGScCoq7-b CCCCCGGGGCCACTTTCTGGTGSpcoq7 -a GTACAAGCTTGTAAATTTTCGATGGSpcoq7-b CATAGAATTCTTGGTAATCSpcoq7-c AAAGTCGACATGTTGTCACGTAGACAGSpcoq7-w CAAGCAGGTGAATTAGGCSpcoq7-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... of the soleGlyco_18 domain, the C-terminal tail of C. gigas CLPsmay not noticeably contribute to the structure and the function of these proteins. Interestingly, Cg-Clp1 and Cg-Clp2 C-terminal ... Oyster chitinase-like proteins FEBS Journal 274 (2007) 36463654 ê 2007 The Authors Journal compilation ª 2007 FEBS 3651 Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in ... 2007)doi:10.1111/j.1742-4658.2007.05898.x Chitinase-like proteins have been identified in insects and mammals as non-enzymatic members of the glycoside hydrolase family 18. Recently, the firstmolluscan chitinase-like protein, named Crassostrea...
- 9
- 584
- 0
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... H+-ATPase inhibitor bafilomycin and the cathepsin D inhibitor pepstatin Apartially inhibited, both in vivo and in vitro, the cAMP response to cholera toxin. This cathepsin D- dependent action of cholera ... action of cholera toxin in rat liver parenchyma. Following administration of a saturating dose of cholera toxin to rats, rapid endocytosis of both cholera toxin subunits wasobserved, coincident ... FEBS Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity Tatiana El Hage1,2,*, Clemence Merlen1,2*, Sylvie Fabrega1,2 and Francáois...
- 16
- 536
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... recy-cling. Initiation is the rate-limiting step [1] . This phaseis mediated by initiation factor 1 (IF1), initiation fac-tor 2, and initiation factor 3. IF1 is the smallest of the initiation factors ... chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline; TIR, translation initiation region. FEBS Journal 278 (2 011 ) 17 4 517 56 ê 2 011 The Authors Journal compilation ê 2 011 FEBS ... over-expression of era, encoding the GTPase Era. The primersused were as follows: era_F_NcoI, CGACCATGGCGAACAGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGACAGCCTTCCATCGGAGTTACT. The resulting vectorwas termed...
- 12
- 439
- 0
Báo cáo khoa học: Complementation of coenzyme Q-deficient yeast by coenzyme Q analogues requires the isoprenoid side chain ppt
... (h)A60002468101214024487296Wild-typeDcoq2 + 50 àM CoQ2Dcoq2 + 50 àM decylQDcoq20246810A600DCoQCoQ2DecylQA1 -Q 2A4 -Q 2A5 -Q 2A6 -Q 2A3 -Q 2A2 -Q 2ABOOMeOMeOA1 -Q 2OOMeOMeOA6 -Q 2OOMeOMeOA5 -Q 2OOMeOMeOA4 -Q 2OOMeOMeOA3 -Q 2OOMeOMeOA2 -Q 2OOMeOMeODecylQOOMeOMeOCoQ2OOMeOMeOCoQ6CFig. ... ubiquinones.Results Complementation of cell growth in CoQ-deficient yeast by short -chain CoQ analogues shows adramatic dependence on the isoprenoid side chain Yeast strains that cannot synthesize CoQ endoge-nously ... 2010 The Authors Journal compilation ê 2010 FEBS Complementation of coenzyme Q- deficient yeast by coenzyme Q analogues requires the isoprenoid side chain Andrew M. James1, Helena M. Cocheme´1,2,...
- 16
- 499
- 0
![Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot](https://media.store123doc.com/images/document/14/rc/ld/small_ldo1394248806.jpg)
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot
... Membrane -reconstituted human CYP1A1 (Eur. J. Biochem. 269) 1805 PRIORITY PAPER Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity ... correlation between the activation of the CYP1A1- catalyzed epoxidation reaction of 7,8-diols a nd the enhanced nonbilayer phase propensi ty in membranes containing PtdEtn.Effect of lipids on the stereoselectivity ... that in addition to the membrane charge, the nonbilayer phase propensity of the membrane is animportant determinant for an effective reconstitution of CYP1A1- dependent epoxidation activity. The...
- 7
- 376
- 0
Báo cáo khoa học: Mitochondrial transcription factor A overexpression and base excision repair deficiency in the inner ear of rats with D-galactose-induced aging pdf
... charac-teristics resemble those of the natural aging process in humans and other animals. As the inner ear tissue isunacquirable during life in humans, and the genetic and environmental background ... capacity to repair oxidative DNA damage in various brain regionsduring aging was altered in an age-dependent manner, and increased mtDNA oxidative damage might con-tribute to the normal aging process ... increased mutation load in the inner ear. In our study, increases in TFAM expression and dele-tion mutation load were demonstrated in the inner ear of d-Gal-treated rats. The replication of mtDNA is...
- 11
- 450
- 0
Báo cáo khoa học: " Seroprevalence of low pathogenic avian influenza (H9N2) and associated risk factors in the Gyeonggi-do of Korea during 2005-2006" pps
... houseDegree of taking instructions from ownerĐFoot disinfectant at the entrance of the buildingFrequency of renewing the disinfectant∥Wearing separated boots at each buildingOn the farmOff ... experimentally in- oculated with avian influenza viruses of low and high pathogenicity. Avian Dis 1997, 41, 125-136.12. Naeem K, Naurin M, Rashid S, Bano S. Seroprevalence of avian influenza virus and ... in Korea. In addition, to reduce the risk of the introduction of the LPAI (H9N2) virus into farms, it is strongly suggested that farm employees should be more proactive in the prevention of...
- 8
- 367
- 0
Báo cáo khoa học: " quality of Douglas fir (Pseudotsuga menziesii (Mirb) Franco) from three stands in the Netherlands*" pptx
... 10% of the timberwas ranked as quality class B (good quality) , ...
- 10
- 243
- 0
Báo cáo khoa học: "Effect of edging and docking methods on volume and grade recoveries in the simulated production of flitches" pps
... jthedger sawline and kth docking sawline; Original articleEffect of edging and docking methods on volume and grade recoveries in the simulated production of flitchesCL ... flitch. In the following extract, the term’trimming’ is equivalent to docking ; and ’cutting-line combinations’ refers to the com-binations of edging and docking lines." ... variation of cutting lines. Cutting line combinationswere generated by varying the coordinates of each edging and trimming line betweenpredetermined limits." These limits,...
- 8
- 343
- 0
Báo cáo khoa học: " spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France)" ppt
... df) between Original articleEstablishment and spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France) ... resultfrom the fact that, in the Forêt du Mézenc, R grandis is still invading the stand, and that its spread in space involves most of the popu-lation which would otherwise ... diffusion of the predators from the release plot. Details of the plots are given in table I.Additional sampling In order to obtain additional information on the effects of distance...
- 8
- 168
- 0
báo cáo khoa học:" Efficacy of low level laser therapy on neurosensory recovery after injury to the inferior alveolar nerve" ppt
... in their perception of their malocclusion. Also,there is no evidence of how the severity of those traits isperceived by people. These shortcomings of the IOTNindicate the need to study the ... anyone to seek treatment regardless of the severity of his or her malocclusion. Therefore, it is recom-mended to use the DHC of the IOTN as a screening tool to reevaluate the waiting lists of ... eachsubject to evaluate his or her own attractiveness by com-paring it to the standard photographs of the AC of the IOTN. Two examiners were involved in the study, one for the DHC and the other for the...
- 6
- 267
- 0
báo cáo khoa học:" Efficacy of low level laser therapy on neurosensory recovery after injury to the inferior alveolar nerve" ppsx
... CentralPage 1 of 9(page number not for citation purposes)Head & Face MedicineOpen AccessResearch Efficacy of low level laser therapy on neurosensory recovery after injury to the inferior alveolar ... I, Peterson LJ: Clinical efficacy of low level laser treatment of oro-facial neurosensory deficits. J OralMaxillofac Surg 1993:182.26. Walsh LJ: The current status of low level laser therapy ... lower lip, chin and the region of mental foramen (Figure 2); intraorally: the mentalforamen region, buccally in the region of the apicies of the first molar, and lingually in the region of the...
- 9
- 360
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
... BbrizUBCE and BbrizTUB were again the more stable and the least stable genes respectively, while there was a slight difference in the order of stability of the other genes. The second and third best reference ... both apomictic and sexual reproduc-tion within Brachiaria makes it an interesting system for understanding the molecular pathways involved in bothmodes of reproduction. The identification of genes involved ... reproductive mode and ploidy level influ-ence in expression levels of commonly used reference genes and if they will be used for apomixis molecular studies, stability in ovaries of sexual and apomictic...
- 10
- 267
- 0
Báo cáo khoa học: "Effect of sedation with detomidine and butorphanol on pulmonary gas exchange in the horse" pps
... match. Detomidine sedation The impaired pulmonary gas exchange and arterialoxygenation during detomidine sedation in the presentstudy reconfirm previous observations during sedation of horses with a2-agonists ... investigation was to determine the physiological effects, especially on the pulmonary gas exchange, of sedation with detomidine alone and in combination with butorphanol. MethodsHorsesSeven Standardbred ... to the values during detomidine sedation. This is in line with earlierinvestigationonsedationinthehorse[17]thathasshowed a reduction in vascular resistance over time.Conclusion The results of...
- 9
- 338
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ