Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

... are suitable for a clear dis-Original article Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversyG AasChair ... supported by the findings of this project. Quercus robur / Quercus petraea /taxonomy / morphological variation / hybridizationRésumé — Impact taxonomique de la variation morphologique ... Watsonia 11, 229-236Rushton BS (1978) Quercus robur L and Q pe-traea (Matt) Liebl: a multivariate approach to the hybrid problem. 1. Data acquisition analy-sis and interpretation....

Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

... ACL and AFNLPAutomatic Adaptation of Annotation Standards:Chinese Word Segmentation and POS Tagging – A Case StudyWenbin Jiang†Liang Huang‡Qun Liu††Key Lab. of Intelligent Information ... decoding isanalogous to the training. First, the character se-quence is input into the source classifier to ob-tain an source standard annotated classificationresult, then it is input into the ... Liang Huang, Yajuan Lü, and Qun Liu.2008. A cascaded linear model for joint chineseword segmentation and part -of- speech tagging. In Proceedings of the 46th Annual Meeting of the As-sociation...

Báo cáo khoa học: "Joint Evaluation of Morphological Segmentation and Syntactic Parsing" pptx

... morphological segmen-tation and syntactic parsing using a PCFGLA latticeparser. In Proceedings of ACL.Spence Green and Christopher D. Manning. 2010. BetterArabic parsing: Baselines, evaluations, and ... and analysis. In Proceedings of COLING.Nizar Habash and Owen Rambow. 2005. Arabic tok-enization, part -of- speech tagging and morphological disambiguation in one fell swoop. In Proceedings of ACL.Joakim ... 439–447.Khalil Sima’an, Alon Itai, Yoad Winter, Alon Altman, and Noa Nativ. 2001. Building a Tree-Bank forModern Hebrew Text. In Traitement Automatique desLangues.Reut Tsarfaty and Khalil Sima’an....

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... xenovo-rans LB400 through a PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers ... Wellenreuther and W. Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data ... the carboxylate side chain of either a glutamate or anaspartate. The apparent conﬂict of this ﬁnding with the absence of a coordinating carboxylate in the mod-eled metal center of Bxe _A2 876 is...

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... bifunctional protein was named AUH (‘AU bind-ing homolog of enoyl-CoA hydratase’). The RNA-binding activity of the human protein and also of the murine homologue was investigated further, its ... AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For the kinetic characterization of AUH described in the workat hand, AUH was overproduced in Escherichia coli as a maltose binding ... and AUH RP 5¢-GCCATCGAGGACTCGCACAGAGAATATGAGCT-3¢ (the c.719C>T mutation leading to the amino acid exchange A2 40V is underlined). The AUH genes were proof-sequenced and no secondary muta-tions...

Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf

... kinase domain and interferes with the substratebinding sites. In the case of the titin and twitchinkinases, the autoinhibitory sequence acts as a pseudo-substrate, occluding ATP binding and ... CaM in a 1 : 1 molar ratio and then analysed by gel ﬁltration chromatography. The peakswere concentrated using 3 lL of Strataclean protein bind-ing beads (Stratagene, Amsterdam, the Netherlands) ... with a large conforma-tional change occurring on binding of the peptide and could indicate that the binding of PhK5 to Ca2+⁄ CaM is similar to that observed for Ca2+⁄ CaMbinding to isolated...

Tài liệu Báo cáo khoa học: Improving Classification of Medical Assertions in Clinical Notes" pdf

... responses to our in- quiry. References Apache UIMA 2008. Available at http://uima.apache.org. Jason Baldridge, Tom Morton, and Gann Bierner. 2005. OpenNLP Maxent Package in Java, Available at: ... Biological, translational, and clinical language pro-cessing, Prague, CZ. David Ferrucci and Adam Lally. 2004. UIMA: An Ar-chitectural Approach to Unstructured Information Processing in the Corporate ... cross validation on the training data to measure the impact of each of the four subsets of features explained in Section 3. Ta-ble 3 shows the cross validation results when cu-mulatively adding...

Tài liệu Báo cáo khoa học: "Topological Ordering of Function Words in Hierarchical Phrase-based Translation" pdf

... = 64N = 2048331Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP1 2 3 1123{ }324 ... 128N330X a →    X1, X1Xb→ X1 X2, X1X2Xc→   Xd→ X1  , X1Xe→   , X a XdXbX a XbXd≺X a ≺ Xb≺ Xc≺ Xd≺ XeXd≺ X a ≺ Xb≺ Xc≺ ... ❄❳❳❳❳❳③✘✘✘✘✘✾❄❄ ❄ ❄X a ⇒   Xb, Xb⇒   Xc Xd, XcXd⇒     Xd, Xd⇒     Xe  , Xe⇒        , Xd⇒X a   , X a ⇒  Xb ...

Tài liệu Báo cáo khoa học: "Semantic Classification of Noun Phrases Using Web Counts and Learning Algorithms" ppt

... languages, and the problem of semantic dis-ambiguation of these phrases has many potential applications in areas such as question-answering and machine translation. One very common ap-proach to this ... frequency of the preposition in a paraphrase such as “storm in the desert” and the ease of understanding that phrase. For example, the preposition &apos ;of& apos; is very frequent and could be interpreted ... requires the knowledge that a “storm” may refer both to an event in time and an entity in space. It may be that a combination of semantic information from an ontology and statis-tical information...

Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

... Brilliant Bluestaining.Table 2. Quantitation and comparison of proteins in GM and WI-38cells. From the data in Fig. 2 and others, the concentrations of Mcmproteins, ORC2 and PCNA in total protein ... chromatin-bound proteins(Fig. 3 and Table 2). In contrast, the amounts of totalFig. 4. Abundance of Mcm2 mRNA in HeLa and WI-38 cells. (A) Total mRNA was puriﬁed from HeLa and WI-38 cells, and the ... fragment. These fragments areindicated. (B) Total RNA was puriﬁed from HeLa and WI-38 cells and analyzed by Northern blot analysis. Increasing volumes (0.7, 1.5 and 3 lLeach) of the total RNA...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ