Báo cáo sinh học: "Mycobacterium avium subsp. paratuberculosis linked to Crohn''''''''s Disease and Paratuberculosis" pot
báo cáo sinh học:" Call for manuscripts: "Towards a scaling-up of training and education for health workers" ppt
... from, and complement, tradi-tional community health worker training? ã How can the health professional training be betteraligned with local health needs and be more sociallyaccountable?ã What ... the status of existing collaborations betweendeveloping countries aiming to improve health worker education? ã How have modifications in healthcare management hadan impact upon health workforce ... developed and tested for customizing the workforce skill mix to local health service needs? For example, what impact have recent health sector reforms had on the local health workforce?ã What is...
- 2
- 415
- 0
báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx
... WHODepartment of Human Resources for Health and former Minister of Health for the Philippines to launch the feature with an opening editorial to be found in the journal's blog.This opening article ... systems ofleading and managing human resources for health do notwork in today's context. In these cases and others, a moreappropriate mode of leadership, linked to reforming man-agement ... even with adequate funding, efforts to implement HR plans and obtain results may fail due to other factors.Factors that contribute to the failed implementation of human resource strategies▪...
- 4
- 437
- 0
báo cáo sinh học:" A systematic review of task- shifting for HIV treatment and care in Africa" potx
... Kukasha W, Ahoua L, Le Paih M, Munger A, Kabwinja A, Mpunga J, Chazel E, Jeannin A, Szumilin E, Kamoto K, Harries A: Nurses and medical assistants taking charge: task -shifting HIV care and HAART ... Impact of task -shifting and joint efforts in the provision of care and antiretroviral treatment to infants and children in a resource constrained setting. AIDS 2008 - XVII International AIDS ... distribution, and reproduction in any medium, provided the original work is properly cited. Review A systematic review of task- shifting for HIV treatment and care in AfricaMike Callaghan*1, Nathan Ford2,3...
- 9
- 532
- 0
báo cáo sinh học:" Sharing best practices through online communities of practice: a case study" potx
... STU D Y Open Access Sharing best practices through online communities of practice: a case studyAnnamma Udaya Thomas1*, Grace P Fried2, Peter Johnson1, Barbara J Stilwell3AbstractIntroduction: ... developmental status of students, allocation of scarce clinical and academic resources, space within analready crowded program of study and clinical compe-tency of available faculty must all be ... contributors to analysis of GAPS forums: Barb Deller and Ricky Lu.Other moderators: Julia Bluestone and Barb Deller.Acquisition of data and monitoring of submissions: Karnika Bhalla andAlishea Galvin.Financial...
- 8
- 458
- 0
báo cáo sinh học:" The human resource for health situation in Zambia: deficit and maldistribution" docx
... available soon. The human resource for health situation in Zambia: deficit and maldistribution Human Resources for Health 2011, 9:30 doi:10.1186/1478-4491-9-30Paulo Ferrinho (pferrinho@ihmt.unl.pt)Seter ... train, retain. The AIDS and health workforce plan. Report on the consultation on AIDS and human resources for health. WHO, Geneva, May 2006. 22. Tawfik L, Kinoti SN: The impact of HIV/AIDS in ... 70% in the Western and Copperbelt provinces; for Level 1 facilities, 54% and 80% for the Southern and Western provinces. For rural health centres, rates varied between 15% and 63% (Lusaka and...
- 29
- 327
- 0
Báo cáo sinh học: " Human neuronal cell protein responses to Nipah virus infection" docx
... to examine the human neuronal cell protein responses to NiV infection.ResultsComparison of 2D-PAGE protein profiles of NiV-infected SK-N-MC cellsThe NiV-infected and mock-infected human neuronal cells ... present study, we examine the human neuronal cell protein responses to NiV infection and compare it to thatof the mock-treated cells. The focus on neuronal cells is to help in understanding the ... [12].This can lead to the rupture of the mitochondrial outermembrane and release of the mitochondrial proapoptoticfactors [29]. These factors then induce apoptosis to the neuronal cell cultures...
- 9
- 431
- 0
Báo cáo sinh học: " Carlow Virus, a 2002 GII.4 variant Norovirus strain from Ireland" pot
... TCATTCGACGCCATCTTCATT (5084–5104) -4290 F TCACTATGATGCTGATTACTC (4282–4302) -NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) +NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) - Virology Journal 2007, ... 481 A 540 BAF38397 480 P A 539 AAL18873 481 Y P V 540 AAD40497 480 P A 539 AAT12693 480 P A 539 AAD40488 480 P A 539 AAT12696 480 P A 539 AAL79839 480 P A 539 AAL18876 480 P A 539 AAT12689 ... Disease, Bethesda, Maryland, USA.References1. Okada M, Tanaka T, Oseto M, Takeda N, Shinozaki K: Genetic anal-ysis of noroviruses associated with fatalities in healthcarefacilities. Arch...
- 9
- 348
- 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... 1 of 5(page number not for citation purposes)Virology JournalOpen AccessResearch Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/AlixShuzo Urata1,2,3, Hideyoshi Yokosawa3 and ... mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins.Results: Here, we report that DN forms of Vps4A, Vps4B, and AIP1 inhibit HTLV-1 ... fetal bovine serum and penicillin-streptomycin at 37°C.The involvement of Vps4A and Vps4B in HTLV-1 Gag bud-dingFigure 2The involvement of Vps4A and Vps4B in HTLV-1 Gag budding. A. 293T cells...
- 5
- 303
- 0
Báo cáo sinh học: " An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion protein" doc
... ECTV and tropomyosin withinthe cell. Subsequent immunofluorescence studies exam-ining the association of ECTV-PH, tropomyosin, and ATIproteins with viral membrane proteins and actin, and examining ... citation purposes)Virology JournalOpen AccessResearch An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion proteinChristine Butler-Cole, Mary J Wagner, ... Control cells, infected with vTF7-3 and transfected with calf thymus DNA, show DAPI staining of cellular nuclei and little background staining with anti-HA and anti-Myc antibodies (negative control)....
- 15
- 404
- 0
báo cáo hóa học: " Gait dynamics in mouse models of Parkinson''''s disease and Huntington''''s disease" doc
... Parkinson's disease (PD) and Huntington's disease (HD), but gait dynamics in mouse models of PD and HD have not been described. Here wequantified temporal and spatial indices of gait dynamics ... studies of gait and gait variability in mouse models of PD, HD, and ALS.Competing interestsThomas G. Hampton is owner of Mouse Specifics, Inc., acompany organized to commercialize the gait imagingtechnology ... transgenic miceTo compare gait variability in the MPTP and 3NP mouse models of basal ganglia disease to a mouse model of motor neuron disease, we also examined gait in a mouse model of amyotrophic lateral...
- 13
- 413
- 0
Báo cáo hóa học: " A Constrained Least Squares Approach to Mobile Positioning: Algorithms and Optimality" pot
... nAOA,iis the noise in rAOA,i.Equation(14) can also beexpressed in vector form asrAOA= fAOA(x)+nAOA, (15)whererAOA=rAOA,1rAOA,2···rAOA,MT,nAOA=nAOA,1nAOA,2···nAOA,MT,fAOA(x) ... {nTDOA,i},{nRSS,i} ,and{ nAOA,i} are sufficiently small and aremodeled as zero-mean Gaussian random variableswith known covariance matrices, denoted by Cn,TOA,Cn,TDOA, Cn,RSS,andCn,AOA,respectively.Thezero-mean ... of abbreviations and symbols.AOA Angle-of-arrivalCWLS Constrained weighted least squares CRLB Cram´er-Rao lower boundNLS Nonlinear least squares RSS Received sig nal strengthTOA Time-of-arrivalTDOA...
- 23
- 360
- 0
Báo cáo sinh học: "Mycobacterium avium subsp. paratuberculosis linked to Crohn''''s Disease and Paratuberculosis" pot
... Mycobacterium avium subsp. paratuberculosis linked to Crohn's Disease and Paratuberculosis Stefania Zanetti1,2, Paola Molicotti1, Sara Cannas1, Silvia Ortu1, Niyaz Ahmed2,3 and Leonardo ... BackgroundCrohn's disease, a human disease similar to paratubercu-losis in animals is the most painful and devastating dis-ease that may involve infection with M. avium subsp. paratuberculosis ... M, Dettori G, FaddaG, Zanetti S: Detection and isolation of Mycobacterium avium subspecies paratuberculosis from intestinal mucosal biopsiesof patients with and without Crohn's disease...
- 3
- 273
- 0
Báo cáo y học: "Granulomatous cheilitis associated with exacerbations of Crohn''''s disease: a case report" potx
... granulomas and epithelioidhistiocytes. Melkersson-Rosenthal syndrome (a triad of orofacial swelling, facial paralysis and a fissured tongue)is one manifestation of orofacial granulomatosis, ... commonly presents as granulomatous cheilitis alone [5-10]. Most reported cases of orofacial granuloma-tosis have been in adults and some in adolescents. Orofa-cial granulomatosis in the paediatric ... Kolokotronis A, Antoniades D, Trigonidis G, Papanagiotou P: Gran-ulomatous cheilitis: a study of six cases. Oral Dis 1997,3:188-192.6. Sciubba JJ, Said-Al-Naief N: Orofacial granulomatosis: presenta-tion,...
- 4
- 333
- 0
Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx
... Access Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case reportRobin H Johns1*, Tomas Doyle2, Marc ... report the case of a 46 year old Zambian woman who presented with pyrexia, diarrhoea and vomiting, confusion, lymphadenopathy, and renal failure. She rapidly developed multiple organ failure following ... tomography (CT) t horax and abdomen with intravenous contrast enhancement showinghepatosplenomegaly, axillary and abdominal lymphadenopathy.Figure 2 Inguinal lymph node biopsy: histology characteristic...
- 6
- 337
- 0
Báo cáo sinh học: "The evolutionary history of Drosophila buzzatii. XVII. Double mating and sperm" pot
... population. Evolution 40, 740-755 Original articleThe evolutionary history of Drosophila buzzatii. XVII. Double mating and spermpredominanceA BarbadillaJE Quezada-Díaz,A RuizM ... in males and double mating in females have been studiedin 2 stocks of the cactophilic species Drosophila buzzatii. The relationship between double mating and total productivity ... frequency of double mating and its influence on the total femaleproductivity were determined. D buzzatii belongs to the repleta group of Drosophila and several aspects of its...
- 8
- 227
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậthost pathogen interactions and intracellular survival of mycobacterium avium subsp paratuberculosisbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP