Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf

... articleAboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern SpainI Santa Regina1T TarazonaR Calvo31IRNA-CSIC;2JCL;3INIA, ... in beech and pine forests indicates a larger biomass and litterfall in the latter. Although the produc-tivity according to diameter class was higher in the beech forest, ... zoneforests of the Sierra de la Demanda, Burgos, Spain.Arid Soil Res Rehab 9, 201-207Santa Regina I, Gallardo JF, Rico M, Martin A, GallegoHA, Moreno G, Cuadrado S...

Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx

... (section 4). The appli-cation domain is a tourist information system foraccommodation and events in the local area. The domain of the trained DMs is identical to that of a rule-based DM that was used ... Italy{varges|silviaq|riccardi|ivanov|roberti}@disi.unitn.itAbstractOver several years, we have developed anapproach to spoken dialogue systems thatincludes rule-based and trainable dialoguemanagers, spoken language understanding and generation modules, ... candidate se-mantic parses using the semantics of a domain on-tology and the output of ASR. The visualization of the internal representation of the POMDP-DM includes the N best dialoguestates after...

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

... that arise often (and are often intractable) in the use of a proba-bilistic model: “what are the marginal probabili-ties of each individual variable?” and “what is the set of values with the ... conceptsas a pair of sentence (e, f), plus an alignment a. a is a set of links, a link being represented as a pair of positions in each side of the sentence pair (the special position -1 indicating the ... mathematically, they represent a factoriza-tion of the joint probability of these variables.Formally, a factor graph is a bipartite graph with2 kinds of nodes. On one side, the Variable Nodes(abbreviated...

báo cáo khoa học: " Cross-species EST alignments reveal novel and conserved alternative splicing events in legumes" ppsx

... GAATGGATATTAAAGGAGTTGTTGCAGAGATCCTAATGGACAAAAATACGTCTCTTGTGCAAAAGAt2E3 GGATGGATATTAAAGGAGTTGCTGCAGAAATCCAAAAGGACAAAAACACACCTCTTGTGCAAAAGOsE3 GGATGGATATTAAGGGTGTTGCAGCAGAAATTCAAAAGGACAAGAGCACACCACTTGTGCAAAAG ... V A E I Q K D K S T P L V Q KMtE3 GTATGGATATTAAAGGGGTTGTTGCTGAAATACAGAAGGACAAAAGCACACCTTTAGTGCAAAAGLjE3 GTATGGATATTAAAGGGGTTGTTGCTGAAATACAAAAGGACAAAAGCACACCTTTAGTGCAGAAGAtE3 GAATGGATATTAAAGGAGTTGTTGCAGAGATCCTAATGGACAAAAATACGTCTCTTGTGCAAAAGAt2E3 ... I A M K N N L S D V I EMtE4 GCGGTGATGTGAAGCACATAGCAATGAAAAACAACCTATCAGATGTGATTGAGLjE4 GCGGTGATGTGAAGCAGATAATAACCAAGAACCACCTGTCAGATATGATTGAGAtE4 GCGGTGATGTGAAGCAGATTACATCCAAAAATCAATTGTCAGATATGATAGAGOsE4...

Báo cáo khoa học: " Systemic hypothermia increases PAI-1 expression and accelerates microvascular thrombus formation in endotoxemic mice" ppsx

... with the German legislation on pro-tection of animals and the National Institutes of Health 'Guidefor the Care and Use of Laboratory Animals' (Institute of Lab-oratory Animal Resources, ... to faint staining; 2 to moderatestaining; and 3 to intense staining. As there were no notabledifferences in arteriolar and venular endothelial staining, ves-sels were not differentially assessed. ... a rectal probe. A midlineincision of the skin and fascia was made over the ventralaspect of the scrotum and extended up to the inguinal fold and to the distal end of the scrotum. The incised...

Báo cáo khoa học: "Root biomass and biomass increment in a beech (Fagus sylvatica L.) stand in North-East France." doc

... R., Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain, Ann. Sci. For. 54(1997) 261–269.[33] Stober C., Eckart G .A. , Persson H., ... means that root system biomass continues toincrease at a steady rate with age, but also that the rate of increase of root system biomass decreases dramaticallywhen the stands get older. Stand ... dominance. The same pattern of variation wasobserved with biomass increments of coarse and smallroots (figure 5b).3.2. Stand level3.2.1. Biomass and biomass increment The stand biomass and the biomass...

Báo cáo khoa học: "Belowground biomass and nutrient content in a 47-year-old Douglas-fir plantation" pptx

... root biomass was 58 t of dry matter, which was 18% of the total stand biomass. A linear model characterized the relationships bet-ween aerial and belowground biomass of 38 Douglas-fir stands ... 0.9. A rather low coeffi-426 J. Ranger and D. GelhayeTable II. Main stand characteristics.Number of trees per ha Mean tree circumference Mean tree basal area Basal area per ha Mean stand height350 ... contentof the4 7-year-old Douglas-fir stand(data int per haofdry biomass at 65oC and in kg per ha of dry matter for nutrients). Biomass N P K Ca Mg Biomass N P K Ca Mgb% (a+ b) b% (a+ b) b% (a+ b) b% (a+ b)...

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... with the leastmodiﬁcation of the original model. Of course the modiﬁcation of language models led by the addi-tion and deletion of words is hard to quantify and we choose to add and delete as ... si-multaneously add and delete words. + and - means the number of words added and deleted, respec-tively.For the proposed LAICA approach, we show the results for one (LAICA-1) and two (LAICA-2) iterations ... mostlanguages in ASR, in the Chinese case the problem can be avoided by utilizing char-acter n-grams and moderate performancescan be obtained. However, character n-gram has its own limitation...

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... which maintains the ability of proliferation and invasion. Choriocarcinoma is a malignant neoplasm thatrepresents the early trophoblast of the attachment phase oras later invasive stage [46–48]. ... reported that HDL3was taken up and degradedby BeWo cells in a time- and concentration-dependentfashion, but the rate of degradation was considerably lessthan was the rate of degradation of LDL. ... lipoprotein-associated cholesterol across the placenta from the maternal circulation [4–8]. The fact that the placenta binds and internalizes maternallipoproteins both in vivo and in vitro [8]...

Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

... 0.81ATcAAACA 0.03cATtAAACA 0.01cATGcAACA 0.69ATGgAACA 0.20cI ATGAgACA 0.02cATGAAgCA 0.05cATGAAAgA 0.30III ATGAAACg 0.26 a PREs represented in the FUS1 promoter (Fig. 4B).bRCS for eacholigo ... signiﬁcantTable 1. RCS of mutant PREs for binding of wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro.FUS1 PRE a Sequence RCSbII ATGAAACA 1.00IV tTGAAACA 0.27cAaGAAACA 0.14ATaAAACA 0.81ATcAAACA ... 011). Binding reactions containedno competitor (lane 1), or a 0.625- (lanes 2 and 7), 1.25- (lanes 3 and 8), 2.5- (lanes 4 and 9), 5- (lanes 5 and 10) or 10- (lanes 6 and 11) fold molar excess of...

Xem thêm