Báo cáo y học: "In vivo bactericidal activities of Japanese rice-fluid against H pylori in a Mongolian gerbil model" ppsx
Báo cáo y học: "In vivo bactericidal activities of Japanese rice-fluid against H. pylori in a Mongolian gerbil model" ppsx
... Fukuto Maruta 1, Kazufumi Suzuki 1, Shinichi Miyagawa 1, Masahiko Takeuchi 2, Kiyomi Kanaya 3, Kozue Oana 4, Masayoshi Hayama 4, Yoshiyuki Kawakami 4, Hiroyoshi Ota 4 1. Department ... ©Ivyspring International Publisher. All rights reserved Research Paper In vivo bactericidal activities of Japanese rice-fluid against H. pylori in a Mongolian gerbil model Satoshi Ishizone ... mu-cosal inflammation and epithelial proliferation in the stomach of H. pylori- infected gerbils. It is likely that H. pylori- eradication caused a decrease in the degree of inflammation in the...
- 6
- 219
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... The ability of the mutant strain toresume growth after the stationary phase was then comparedwith that of the parental strain. As shown in Fig. 6A, aftertransfer from stationary cultures into ... 142–144 amino-acids long; they are acidicand presumably located in the cytoplasm like UspA.Members of this family share a strikingly similar hydro-pathy profile (data not shown), and UP12 shares ... further during the late stationaryphase. As a result of this accumulation, the relative amount of UP12 in stationary cells is about 10 times higher than thatobserved at the beginning of growth...
- 9
- 548
- 0
Báo cáo y học: "Antimicrobial and antioxidant activities of Cortex Magnoliae Officinalis and some other medicinal plants commonly used in South-East Asia" doc
... Shahverdi AR, Fakhimi A, Zarrini G, Dehghan G, Iranshahi M: Gal-banic acid from Ferula szowitsiana enhanced the antibacte-rial activity of penicillin G and cephalexin against Staphylococcus aureus. ... health maintenance, anti-aging and chemoprevention.Eight medicinal plants, namely Herba Polygonis Hydropi-peris (Laliaocao), Folium Murraya Koenigii (Jialiye), RhizomaArachis Hypogea (Huashenggen), ... dragon tail, laksa aerial parts, Herba Houttuyniaeaerial parts and curry leaves showed high activities, rodenttuber rhizomes and aerial parts showed low activities. The high antioxidant activities...
- 10
- 421
- 0
Báo cáo Y học: Function and cellular localization of farnesoic acid O -methyltransferase (FAMeT) in the shrimp, Metapenaeus ensis ppt
... be involved in both reproduction andmolting in the crustaceans [5,7]. FAMeT catalyzes themethylation of FA to MF as the terminal step in the MFbiosynthetic pathway. Changes in O-methyltransferaseactivity ... J.,Zhang, Y. , Yan, G., Luo, G., Yang, T. & Shen, J. (2001) Cloningand expression of a single-chain catalytic antibody that acts as a glutathione peroxidase mimic with high catalytic efficiency.Biochem. ... with expression vector only was used as a negative control to check for any bacterial O-methyltrans-ferase activity.Methyltransferase assayThe O-methyltransferase activity of rFAMeT was assayedaccording...
- 9
- 375
- 0
Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
... developedthe language disorder, he was on stable doses of lithium,valproate, quetiapine and perphenazine.Although they appeared approximately 3 years earlier, thefunctional origin of the FAS and agrammatism ... agrammatism, initially categorized as being of psychogenic origin. The patient had an extensive neuropsychological and language evaluation aswell as brain imaging exams. In addition to FAS and ... neuroimaging was initially considered a normal variant for FG's age. The MRI scan showed slightdiffuse cerebral atrophy and an absence of indirect signs of vascular pathology such as hyper intense...
- 7
- 502
- 0
Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc
... Bamba S, Araki Y, OkunoT, Fujiyama Y, Bamba T: IL-17 stimulates inflammatoryresponses via NF-κκB and MAP kinase pathway in humancolonic myofibroblasts. Am J Physiol Gastrointest Liver Physiol2002, ... degradation of inhibitor of κB in RA FLS stimulated with IL-17, indicatingthat IL-17 activates NF-κB in these cells [4]. To examinewhether signaling pathways that lead to the activation of NF-κB are also ... inflammation as dynamicpartners in a mutual activation feedback, via secretion of cytokines and chemokines that stimulate each other. In thisstudy, we investigated the role of IL-17, a major Th1 cytokineproduced...
- 9
- 411
- 0
Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt
... maintainthe cellular homeostasis. Articular chondrocytes that are welladapted to hypoxia into the tissue may express HIF-1α with thedeviating from adaptation to hypoxia. We postulated that ... TGCATGCTATCATTGGCTCATAC CCCGGCAACACACA-MGBrv: CACACCATCTTCTGGTGTACAGTCTHIF-1α fw:CTATGGAGGCCAGAAGAGGGTAT AGATCCCTTGAAGCTAG-MGBrv:CCCACATCAGGTGGCTCATAAGlucose transporter-1 fw:GGGCATGTGCTTCCAGTATGT CAACTGTGCGGCCCCTACGTCTTCrv:ACGAGGAGCACCGTGAAGATfw, ... expression of anti-apoptotic factors oract as a chondroprotective factor to maintain chondrocyte via-bility in the face of catabolic changes in articular cartilage.Many molecular aspects of HIF-1...
- 11
- 385
- 0
Báo cáo y học: "The clinical assessment study of the foot (CASF): study protocol for a prospective observational study of foot pain and foot osteoarthritis in the general population" docx
... self-completed hand manikin [60]AUSCAN [65,66] In the past month, have you had any ache or pain that has lasted forone day or longer in your hand? If yes, shade location on hand manikinPain and stiffness ... manikin [14] In the past month, have you had any ache or pain that haslasted for one day or longer in your feet? If yes, shade painlocation on foot manikinFoot pain intensity in last month ... halluxvalgusBodily pain Self-completed body manikin In the past 4 weeks, have you had pain that has lasted for one day orlonger in any part of your body? If yes, shade location of pain onmanikinRegional pain...
- 16
- 554
- 0
Báo cáo y học: " Pragmatic randomised controlled trial of group psychoeducation versus group support in the maintenance of bipolar disorder" pps
... questionnaire evaluating eight domains of overall health (general health, role physical, physicalfuncti on, bodily pain, vitality, social functioning, roleemotional, and mental health) in the preceding ... Participants are also asked at baseline howeffective they think each of the two trea tments is likelyto be and if they have any preference as to which groupthey are allocated to.The primary outcome ... characterised.* Correspondence: richard.morriss@nottingham.ac.uk1Professor of Psychiatry and Commun ity Mental Health, Institute of MentalHealth, University of Nottingham & Nottinghamshire...
- 10
- 374
- 0
Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot
... IRT analyses consistently showedthat the two items are reliable indicators of the generalattribute. In addition, bifactor analyses showed that thebias in estimated scale reliability was only ... unrealistic for the EDS, asshown by the varying item-factor loadings in the factoranalysis and the varying scalability coefficients in Mokkenscale analysis. Therefore, the Rasch model seems to ... participated in data preparation, statistical analysis, writing themanuscript, and designing the tables; WE participated in statistical analysisand writing the manuscript; GN participated in...
- 19
- 488
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ