Báo cáo khoa học: " Role of protease inhibitors and acylation stimulating protein in the adipogenesis in 3T3-L1 cells" potx
Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx
... CLP.KCs in drug- metabolizing dysfunction during sepsis T H. Kim et al.2312 FEBS Journal 278 (2011) 23072317 ê 2011 The Authors Journal compilation ê 2011 FEBS Role of Kupffer cells in pathogenesis ... factor-a and interleukin-6 weredecreased by depletion of KCs. Our findings suggest that ablation of KCsprotects against hepatic drug- metabolizing dysfunction by modulation of the in ammatory ... signaling is independent of Toll-interleukin 1 receptor domain-containing adaptorprotein. Drug Metab Dispos 36, 95–101.10 Ghose R, Guo T & Haque N (2009) Regulation of geneexpression of hepatic...
- 11
- 769
- 0
Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx
... (2011) 11901202 ê 2011 The Authors Journal compilation ê 2011 FEBS 1191 MINIREVIEW Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis Nicole ... capable of activating fibronectin-independent signalling events. Interestingly, when the purified repeat region 2 or the carboxy-terminus of CagY was immobilized on petri dishes, neither of thesefragments ... membraneproteins to migrate apically. Transcytosis of integrinswould therefore enable H. pylori with the intriguingpossibility of targeting the integrin b1receptor at api-cal membranes (Fig. 1). The...
- 13
- 866
- 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx
... 3525–3601.Ó FEBS 2004 HIV-1 Protease Inhibitors (Eur. J. Biochem. 271) 4461 Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors Hana Petrokova´1, ... onconformation of inhibitor main chain. Thus, different inhibitors differ not only in t he binding affinity, bu t a lso in the degree o f freedom of the inhibitor inside the binding tunnel. Some s pecial inhibitors ... of projections of opposite Sdatoms of M et46 and Met146).Ó FEBS 2004 HIV-1 Protease Inhibitors (Eur. J. Biochem. 271) 4457 Inhibitor binding. The inhibitor OE b inds into the p roteasebinding...
- 11
- 615
- 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf
... recy-cling. Initiation is the rate-limiting step [1] . This phaseis mediated by initiation factor 1 (IF1), initiation fac-tor 2, and initiation factor 3. IF1 is the smallest of the initiation factors ... chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline; TIR, translation initiation region. FEBS Journal 278 (2 011 ) 17 4 517 56 ê 2 011 The Authors Journal compilation ê 2 011 FEBS ... over-expression of era, encoding the GTPase Era. The primersused were as follows: era_F_NcoI, CGACCATGGCGAACAGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGACAGCCTTCCATCGGAGTTACT. The resulting vectorwas termed...
- 12
- 439
- 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... FEBS 29 55 Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20 S proteasome Gustavo M. Silva1 ,2 , Luis E.S. Netto 2 , Karen F. Discola 2 , Gilberto M. ... shown). LC and HC, light and heavy chains of IgG immunoglobulin. Cysteinyl-based modification of the 20 S proteasome G. M. Silva et al. 29 50 FEBS Journal 27 5 (20 08) 29 42 29 55 ª 20 08 The Authors ... corre-sponding author for the article.G. M. Silva et al. Cysteinyl-based modification of the 20 S proteasome FEBS Journal 27 5 (20 08) 29 422 955 ê 20 08 The Authors Journal compilation ê 20 08 FEBS 29 55 Role...
- 14
- 364
- 0
Báo cáo khoa học: Colocalization of insulin receptor and insulin receptor substrate-1 to caveolae in primary human adipocytes Cholesterol depletion blocks insulin signalling for metabolic and mitogenic control doc
... [27]. Insulin receptor signalling in caveolae We next examined the functional status of caveolae- localized receptors. After incubating cells with a submax-imal concentration of insulin the insulin- induced ... the insulin receptor in caveolae. In type 2 diabetes the tissuesrespond poorly to insulin, exhibiting insulin resistance thatcan be overcome by increasing concentrations of circula-ting insulin. ... of signalling proteins including the insulin receptor [40].A further property that distinguishes primary human from rat adipocytes was that insulin stimulation to increasedphosphorylation of...
- 9
- 424
- 0
Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc
... replica-tion at the 5Â-end of the G-quadruplex motif and conse-quently with the generation of duplications containingthis 5Â-region of MsH43. This effect is not observed if the slippage occurs either ... plasmidsubstrates, and leads to enhancement of the fidelity of recombination, as the proportion of equal recombi-nants was higher. The presence of monovalent cations Table 1. Quantitative analysis of recombination ... perfect and nonperfect pairings. We foundthat the presence of monovalent cations led to a higherproportion of equal recombinants, and hence anincrease in the fidelity of the recombination events...
- 11
- 472
- 0
Báo cáo khoa học: Patatins, Kunitz protease inhibitors and other major doc
... 2006 FEBS Patatins, Kunitz protease inhibitors and other major proteins in tuber of potato cv. KurasGuy Bauw, Heidi V. Nielsen, Jeppe Emmersen, Ka˚re L. Nielsen, Malene Jørgensen and Karen ... patatin and certain protease inhibitors reduce the growth of larvae [2–5].Potato tuber protease inhibitors are a diverse groupof proteins that inhibit a variety of proteases and some other enzymes, ... patatins [11,12], and Kunitz protease inhibitors (KPIs) [13–15] of different potato cultivarshave been cloned and sequenced. Based on genetic and molecular analysis, Twell and Ooms [12] estimated...
- 16
- 378
- 0
Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx
... negative carriers) .Monitoring of < /b> HBV DNA loads in subjects receiving lamivudine therapy The level of < /b> HBV DNA was measured in 16 asymptomatic carriers (eight HBeAg positive and eight HBeAg negative)on ... evidence of < /b> previous HBV infection and 350million have become chronic carriers of < /b> the virus, 60 mil-lion of < /b> them residing in Africa [1]. In the Gambia, whereHBV is endemic, the prevalence of < /b> chronic ... antigen (HBsAg) in serum.HBV e antigen (HBeAg) is generally used as secondarymarker to < /b> indicate high levels of < /b> virus in the blood. The minority of < /b> chronic HBV carriers in whom HBeAg can bedetected...
- 7
- 429
- 0
Báo cáo khoa học: " Role of protease inhibitors and acylation stimulating protein in the adipogenesis in 3T3-L1 cells" potx
... and confirm role of ASP in TG biosynthesis and adipogenesis. Keywords: acylation stimulating protein, adipogenesis, 3T3L-1 cellsIntroduction Protease inhibitors (PI) are a class of medications ... chymotrypsin, plasmin and thrombin, 2) EDTA- metalloproteases, 3) leupeptin hemisulfate salt as plasmin and cathepsin, 4) cystein proteases as leucin aminopeptidase and alanyl aminopeptidase. The ... +20-13-2461411E-mail: mohamedsoliman8896@yahoo.com Role of protease inhibitors and acylation stimulating protein in the adipogenesis in 3T3-L1 cellsMohamed Mohamed Soliman1,*, Yakut Abdel-Fattah...
- 5
- 311
- 0
Báo cáo khoa học: " quality of Douglas fir (Pseudotsuga menziesii (Mirb) Franco) from three stands in the Netherlands*" pptx
... 10% of the timberwas ranked as quality class B (good quality) , ...
- 10
- 243
- 0
Báo cáo khoa học: " spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France)" ppt
... df) between Original articleEstablishment and spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France) ... resultfrom the fact that, in the Forêt du Mézenc, R grandis is still invading the stand, and that its spread in space involves most of the popu-lation which would otherwise ... diffusion of the predators from the release plot. Details of the plots are given in table I.Additional sampling In order to obtain additional information on the effects of distance...
- 8
- 168
- 0
báo cáo khoa học: " Barriers to research utilization and research use among registered nurses working in the care of older people: Does the BARRIERS Scale discriminate between research users and non-research users on perceptions of barriers?" pptx
... per-ceptions of barriers to, and facilitators of, research utiliza-tion and to examine the validity of the BARRIERS scale in relation to research use, i.e., the capacity of the Scale to discriminate ... to examine the validity of the BARRIERS scale in relation to research use, i.e., assess the BARRIERS scale& apos;s capacity to discriminate perceptions of barriers between research users and non -research ... to research utilization between research users and non- research users on the Nurse, the Research and the Presen-tation subscales, indicating that the instrument appearsuseful for identifying...
- 10
- 302
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
... BbrizUBCE and BbrizTUB were again the more stable and the least stable genes respectively, while there was a slight difference in the order of stability of the other genes. The second and third best reference ... both apomictic and sexual reproduc-tion within Brachiaria makes it an interesting system for understanding the molecular pathways involved in bothmodes of reproduction. The identification of genes involved ... reproductive mode and ploidy level influ-ence in expression levels of commonly used reference genes and if they will be used for apomixis molecular studies, stability in ovaries of sexual and apomictic...
- 10
- 267
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP