Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... revealed a characteristic time-dependent increase of the mRNA abun-dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and P4ha2, starting around 4 h of hypoxia, the induction of P4ha2 mRNA being ... as the relative mRNA/b-actin mRNA ratio. The mRNA/b-actin mRNA ratio of the time standards (pools)cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Dataare therefore expressed as relative values ... Ia mRNA remainedunchanged after 12 h of stimulation (Fig. 5A) . The stimu-latory effect of hypoxia and of deferoxamine on P4ha1 and P4ha2 mRNA and PDI mRNA was almost abrogated in Hepa1C4 cells...
- 8
- 434
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... the putativepolyadenylation signal AATAAA, and also the sequencesupstream and downstream of the canonical polyadenylationsignal are important for protein binding to D-TERM DNA. The binding specificity ... however,yielded a major termination downstream of AAUAAAsignal at the end of CAA*, A being the terminal nucleotide16 295 of the mouse mt genome (189 nt transcript; Fig. 7A and C, lane 4). An additional major ... Ji-Kang Fang and Narayan G. AvadhaniLaboratories of Biochemistry, Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania,Philadelphia, Pennsylvania, USATermination...
- 13
- 415
- 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGAAACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAGCTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... hTRa1cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGGAACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGGGTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ .In order to overexpress 4-1BB and TRAF1 in the HeLaTRcells, the entire coding ... Pharmaceutical Co. Ltd,Kajiwara, Kamakura, Kanagawa, JapanThyroid hormone has various effects on cell proliferation,growth and apoptosis. To gain more insight into the molecular dynamics caused...
- 10
- 491
- 0
Báo cáo khoa học: " Ipsilateral irradiation for well lateralized carcinomas of the oral cavity and oropharynx: results on tumor control and xerostomia" pot
... nutri-tion and speech, and accelerating dental decay [1]. Xeros-tomia is caused from bilateral irradiation of the majorserous-producing glands, mainly the parotids, and the minor salivary glands ... This was likely related to the combined sparing of the contralateral parotid and part of the contralateral sub-mandibular gland. Certainly, the salivary function can befurther preserved using ... irradiation is the standard approach for manytumor locations and stages. Increasing knowledge on the pattern of nodal invasion leads to moreprecise targeting and normal tissue sparing. The aim of the...
- 8
- 311
- 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... toemphasize what Streat and coworkers [15] termed, the largerisk of unacceptable badness’, rather than a vanishingly smallpotential for benefit.There are far worse things than death, and many of ... unsuccessful in achieving a stated goal. Therefore, if a patient in a progressive,inevitable death spiral is placed on mechanical ventilation,it is not technically futile if vital signs are sustained,however ... tomanipulate it. Life support generates an outcome that isno longer inevitably fatal.4. Physicians do not have an exceptional track record in explaining end -of- life issues to patients and their...
- 2
- 463
- 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... Y, Sakai F & Nagahama Y (2010) Doublesex- and Mab-3-related transcription factor-1 repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia. Endocrinology ... males, abundant dmrt1 expression duringpreparatory and prespawning and spermatogenesisperiods was seen, in contrast to a gradual decreasethereafter during spawning ⁄ spermination. This indi-cates ... Natl Acad Sci USA 99,11778–11783.9 Matsuda M, Nagahama Y, Shinomiya A, Sato T,Matsuda C, Kobayashi T, Morrey CE, Shibata N,Asakawa S, Shimizu N et al. (2002) DMY is a Y-spe-cific DM-domain...
- 10
- 860
- 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx
... InstitutionalAnimal Care and Use Committee of the Center South Uni-versity, and were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All ... min. After centrifugation(10 000 g, 1 min, 4 °C), the protein concentration in the supernatant was determined using the BioRad proteinassay. Supernatants containing equal amounts of protein(corresponding ... spe-cific to each target cDNA were: nucleolin, forward, 5-CAATCAGGCTGGAGTTGCAAG-3; and reverse, 5-TGGCCCAGTCCAAGGTAACTT-3 (amplicon size: 282 bp);GAPDH forward, 5-ACCACAGTCCATGCCATCAC-3; and reverse,...
- 11
- 614
- 0
Tài liệu Báo cáo khoa học : Các phương thức thể hiện lời nói trên đài phát thanh docx
... thdc nay la phdng vien, bien tap vien ed uy tin, cd kinh nghiem eua Dai. Mdt .sd nha bao trong Diin din Kinh te, Diin din Khoa hpc va Cdng nghi. Bin trdn im nhac, Diin dan Giio due da ... trade ma phai bat ra tu hien thyc sinh ddng, Ngudi ndi phai xu ly cung mdt ldc rat nhidu cdng viee: vua quan sat hinh anh thu dugc td camera, quan sat mdn hinh bien tap, ket ndi dien thoai, ... nhat, cudng do manh nhat: Va biy gid, cic ban co biet vi khich mdi tiip theo cua chung ta la ai khdng a? Laaia? Vang, hiy cung hudng lin sin khiu va ndng nhiit chio don: ca si Ha...
- 6
- 741
- 1
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 5′3′UAAAUGUGAAUACAAUGUGAAA GCUAAGAGUUAIL6R ... 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA ... 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a 253120 A B18161412**10EGFP intensity86420EGFPEGFP-IL6R...
- 9
- 541
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ