0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Neuropharmacological effects of deltamethrin in rats" pot

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... fromGiardia lamblia, which contains a Trp residue at the structurally equiva-lent position, establishes the need for complementary mutations and maintenance of weak interactions in order to accommodate...
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... the involvement of DNA gyrase in the antimicrobial effects of H4-(8 6–1 00) and related compounds was obtained in vitro by the mea-surement of their inhibitory activity on the supercoiling of pBR322 ... those of the inactive antimicrobial fragmentsHNb-( 1–1 3) and HNb-( 3–1 3) (Table 2) were not signifi-cant (Fig. 6B).The antimicrobial and anti -DNA gyrase potencies of HNr, H4-(8 6–1 00), compound 3 and ... inability of OGP [or H4-(8 9– 102)] to inhibit DNA gyrase was also in accordancewith its low antimicrobial activity (Fig. 6B and Table 2).Comparison of the DNA gyrase inhibitory activity of HN with...
  • 12
  • 756
  • 0
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... predominanttranscript in the adult intestine and in the developingembryo, whereas Mxi1-SRb transcripts predominate in the adult liver and kidney [12]. In our initial description of Mxi1-SRa and ... arising in the REF assay. E1 is from a Myc + Ras +empty vector point, a1 and a2 are from Myc+ Ras+ Mxi1-SRa points, and b1 and b2 are from Myc+ Ras+ Mxi1-SRb points. TheSRa -myc and SRb -myc ... presence of this domain isresponsible for the differential effects of introduced Mxi1-SRa and Mxi1-SRb in the REF assay. Anexpression construct was generated encoding a Myc- tagged version of Mxi1-SRa...
  • 11
  • 586
  • 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... Journal compilation ê 2006 FEBS 3167 Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix Pei-Tzu Wu1, ... VVA2 can useVVA1 as a basis for the formation of VVA2 oligomers. Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 responsible fordirect interaction with ... demonstratedthat volvatoxin A consists of volvatoxin A2 and volvatoxin A1, and thehemolytic activity of volvatoxin A2 is completely abolished by volvatoxin A1 at a volvatoxin A2 volvatoxin A1...
  • 12
  • 585
  • 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... investigatedby studying the functional effects of deleting the motif in EF -Ts, both in vivo and in vitro. The motif was deleted in endogenous EF -Ts in E. coli strain UY211 by genereplacement, and the phenotype ... reduced.Stability of the EF-Tu–EF -Ts complex in the presence of kirromycin The growth of GRd.tsf in the presence of kirromycin wasexamined because the binding of kirromycin and EF -Ts toEF-Tu has ... show the positions of the protruding coiled-coil motif (residues 187–226) and the C-terminal module. The terminal positions of the deletion of the coiled-coil motif and the insertion of the linker...
  • 12
  • 502
  • 0
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

... Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release Joanna E. Chivers1, Lisa M. Cambridge1, ... and RU486 (< 1 lM) was withoutsignificant effect. Thus, two pharmacologically distinct mechanisms of glucocorticoid- dependent repression of prostaglandin E2 release are revealed. First, glucocorticoid- dependent ... EC50values for repression of PGE2 release, and the repression of arachidonic acid release by RU486 (33.1 and 26.2 nM, respectively), correlate closelyand therefore support the suggestion of a mechanisticallydistinct...
  • 11
  • 527
  • 0
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... MOAT-C and MRP5),a member of the ABC family of proteins, has anionC P. Wu et al. Plant polyphenols modulate MRP1, 4 and 5 FEBS Journal 272 (20 05) 47 25 47 40 ª 20 05 FEBS 47 39 resveratrol, MK -57 1 and ... Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) Chung-Pu Wu 1,2 , Anna Maria Calcagno2, Stephen B. Hladky1, Suresh V. Ambudkar2 and ... 21.3 141 .6 ± 30.6 157 .6 ± 48 .8 161.7 ± 50 .4 151 .5 ± 40 .8Naringenin 3 14. 4 ± 70.8 252 .3 ± 55 .0 266.9 ± 78 .4 309 ± 86 .5 338.2 ± 86.8Hesperetin 207.9 ± 51 .5 131.7 ± 19.8 200.8 ± 49 .3 162 .4 ± 34. 4 180.4...
  • 16
  • 517
  • 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... compilation ª 2009 FEBS The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 Christian Freese1,*, Alistair N. Garratt2, Falk Fahrenholz1and Kristina Endres11 Institute of Biochemistry, ... interact.Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibro-blasts [55] suggested only a minor influence of ADAM10 on neuregulin-1 shedding, but any positiveproof ... O-gly-cosylation of NRG-1 [54], the deviation in the size of the soluble protein fragment may depend on differentglycosylation patterns in the investigated cell lines. Inmouse brain membranes, a panel of...
  • 13
  • 487
  • 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... 2005 FEBS 6115 Mutual < /b> effects < /b> of < /b> proton < /b> and < /b> sodium < /b> chloride < /b> on< /b> oxygenation < /b> of < /b> liganded < /b> human < /b> hemoglobin< /b> Oxygen < /b> affinities < /b> of < /b> the < /b> a < /b> and < /b> b subunits Sergei V. Lepeshkevich and < /b> Boris M. DzhagarovInstitute ... (3) and < /b> (4), the < /b> dissociation rate con-stant, k, and < /b> the < /b> O2affinity, K , can be derived for both the < /b> a < /b> and < /b> b subunits from the < /b> averaged parameters of< /b> HbA oxygenation < /b> (Table 1, Average). The < /b> association and < /b> ... effects < /b> of < /b> pH and < /b> NaCl on < /b> the < /b> bimolecularassociation rate constant of < /b> O2rebinding and < /b> the< /b> quantum yield of < /b> BR for the < /b> a < /b> and < /b> b subunits within the < /b> liganded < /b> dimer and < /b> tetramer of < /b> hemoglobin < /b> weredetermined....
  • 11
  • 577
  • 0
Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

... c remain to beconducted.In conclusion, we found DiS-C3(5) to show multiple effects on the mitochondrial structure and function, effects dependent on both its concentration and the Pistatus.11AcknowledgementsThis ... FEBS 2004 Effects of DiS-C on mitochondrial structure and function (Eur. J. Biochem. 271) 3577 Multiple effects of DiS-C3(5) on mitochondrial structure and function Takenori Yamamoto1,2, Aiko ... was of interest to us to examine the effects of DiS-C3(5) on mitochondrial structure and function in the absence of Pi.Where Ca2+had no effect on the m itochondrial oxygen9consumption...
  • 7
  • 481
  • 0
Báo cáo khoa học: Differential effects of histone deacetylase inhibitors on phorbol ester- and TGF-b1 induced murine tissue inhibitor of metalloproteinases-1 gene expression docx

Báo cáo khoa học: Differential effects of histone deacetylase inhibitors on phorbol ester- and TGF-b1 induced murine tissue inhibitor of metalloproteinases-1 gene expression docx

... on basal expression of Timp-1, only on induced gene expression. In conclusion, this is to our knowledge, the onlydescribed instance of HDAC inhibitors having oppos-ite effects on the same gene, ... action of HDACi could thereforebe either on the Timp-1 gene itself, or on the expression of a protein(s) required for induction of the Timp-1 gene. Time course of TSA action upon PMA- and TGF-b1- induced ... induction and TGF-b1 indu-cing a slower more sustained stimulation of the gene [25]. The effect of TSA on both PMA- and TGF-b1- induced Timp-1 expression is evident as early as 3 hafter addition of...
  • 15
  • 347
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "THE INTERPRETATION OF TENSE IN DISCOURSE" potx

... by TF is the beginning of the interval. What in turn sites the RT of the main clause is the end of the interval. The processing of the first two clauses is just the same as in examples 7a and ... diverge. In 10a-3, the beginning of ADV is most plausibly interpreted with respect to the TF. The end of ADV in turn provides an anaphoric interpretation point for RT 3. Since ET 3 is interpreted ... use the terminology of [8]. (Such a structure is proposed, in part, to give a uniform account of how the interpretation of temporal adverbials interacts with the interpretation of tense and...
  • 8
  • 338
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Psychoimmunological effects of dioscorea in ovariectomized rats: role of anxiety level" pps

... protein. Effects of chronic administration of dioscorea on immobility in the forced swim testFigure 1 Effects of chronic administration of dioscorea on immobility in the forced swim test. Dioscorea ... provide a new insight into the pathophysiological role of IL-2 in postmenopausal anxiety. IL-2 could beinvolved in the mechanisms underlying the behavioral effects of dioscorea. Competing interestsThe ... rats, decreasing anxiety, fear, and pain responses, through actions in cer-tain brain areas [10]. Dioscorea (wild yam) has long beenused as a Chinese medicine for improving gastrointesti-nal,...
  • 8
  • 232
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Beneficial effects of erythropoietin in preclinical models of shock and organ failure" ppsx

... beneficial effects of EPO in preclinical models of shock, trauma and haemorrhage are exciting, but furtherstudies are warranted to determine the effects of EPO onoutcome (organ injury/dysfunction and ... antioxidant and anti-inflammatory effects of EPO, which have been reported in other models of disease[11]. Thus, the beneficial effects of EPO in rodent models of endotoxaemia may vary with doses of ... survival) in models of CLP. Interestingly, in 86 patients admitted to a long-termacute care facility, administration of weekly recombinanthuman EPO (n = 42) resulted in a significant reduction in exposure...
  • 2
  • 174
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP