Báo cáo sinh học: "TBP2 is a general transcription factor specialized for female germ cells" doc
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... manuscript, and participated in the acquisi-tion of data. AZ participated in the coordination of the study.AAZ participated in the design of the study, and performed thestatistical analysis. RA conceived ... production was enhanced byIL-4 and IL-5, and suggests a T-helper lymphocyte type 2cytokine activation in response to sepsis after traumatic injury.Eosinophils normally account for only 1% to 3% of ... butprocalcitonin is known to be among the most promising sepsis markers in critically ill patients, and is capable of complement-ing clinical signs and routine laboratory variables that are sug-gestive...
- 10
- 597
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha-nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... by incubation with casein. Samples and standards were applied in duplicate and incubated overnight at 4°C. Following the Vgf capture phase, the plates were reacted with rabbit anti -Vgf antibody...
- 8
- 499
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... similar to that in Asp141 of Met8P.The idea of NirF being a dehydrogenase is appealingbecause of the presence of a putative nucleotide-bind-ing motif in the N-terminal of the protein sequenceand ... to seek accu-mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental ... the proximal axial ligand to the d1 heme. Replacement of an equivalent His, His41, in NirF byAla abolished binding of the heme to the protein. Known distal heme- binding residues, such as Met,...
- 12
- 613
- 0
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... in uence the GlnK TnrA interaction, either alone, in the absence of divalent metals, or in combination with ATP and Mg2+or Mn2+. To resolve the inhibitoryeffect of ATP on the GlnK TnrA interaction ... affect the binding of ATP to GlnK [12]. Therefore, we investigated the binding of TnrA to GlnK in the presence of differentmixtures of Mg2+or Mn2+ with the effector moleculesATP and 2-oxoglutarate. ... Mutations in TnrA that result in constitutive expression of the TnrA- activated amtBpromoter all lie within the C-terminal region of TnrA, and impair the interaction between GS and TnrA [9,10].Another...
- 11
- 596
- 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... preparations in triplicate. Candida rugosa lipase (CRL) was usedas a positive control for lipase measurement. (Pancreas) lipase activity assays used DGR in a coupled enzyme assay as a sub-strate. ... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar ... encoding a putative ester-ase ⁄ lipase (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical aminoacids are indicated by an asterisk and similar...
- 11
- 568
- 0
Báo cáo sinh học: " Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification" pptx
... JournalOpen AccessResearch Repressor element-1 silencing transcription factor/ neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modificationRajeswara ... (RE-1/NRSE) located between HSV-1 genes ICP22 and ICP4. We predicted thatthe Repressor Element Silencing Transcription Factor/ Neuronal Restrictive Silencer Factor (REST/NRSF) regulates expression ... the Immediate-Early ICP4 and ICP22 genes. RE-1/NRSE is thebinding site of RE1 -Silencing Transcription factor/ Neuro-nal Restrictive Silencer Factor (REST/NRSF) [8]. REST/NRSF is a zinc finger transcription...
- 11
- 215
- 0
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW:GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW:TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTCATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCATCTTCACCTTT, POLR2B.FW:CCTGATCATAACCAGTCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCTGCTTACC.Melting ... 9:100http://www.translational-medicine.com/content/9/1/100Page 2 of 6 RESEARCH Open AccessAurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiationMarco Lo Iacono*, Valentina Monica, Silvia ... interpretation and draftedthe manuscript. MP and GVS participated in study design and coordination,data analysis and interpretation and drafted the manuscript. All authors read and approved the final manuscript.Competing...
- 6
- 300
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. DiscussionWe have developed a TaqMan probe-based QPCR assay toquantitate the viral load of macaque rhadinoviruses belonging ... assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions.Identification of a novel RV2 rhadinovirus in Macaca fascicularis using the RV2 QPCR assay Since ... 6. RV2 QPCR screen of the prevalence of RV2 rhadinoviruses in macaques housed at the WaNPRCDNA samples were obtained from PBMC of a randomassortment of thirty macaques housed at the WaNPRCand...
- 12
- 509
- 0
Báo cáo sinh học: " Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" pptx
... and FACS analysis. BE performed data acquisition from theimmunofluorescence experiments. PR and TK providedcritical reagents and revised the manuscript critically. NS and SN along with MV and ... WJ, Farzan M,Marasco WA: Potent neutralization of severe acute respira-tory syndrome (SARS) coronavirus by a human mAb to S1protein that blocks receptor association. Proc Natl Acad Sci USA2004, ... Seidah2 and Stuart T Nichol*1Address: 1Special Pathogens Brach, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road, Atlanta, Georgia,...
- 10
- 406
- 0
báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx
... Seidah2 and Stuart T Nichol*1Address: 1Special Pathogens Brach, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road, Atlanta, Georgia, ... with MV and EB participated in the plan-ning of the experiments, review and interpretation of data and critical review of the manuscript. All authors read and approved the content of the manuscript.AcknowledgementsWe ... WJ, Farzan M,Marasco WA: Potent neutralization of severe acute respira-tory syndrome (SARS) coronavirus by a human mAb to S1protein that blocks receptor association. Proc Natl Acad Sci USA2004,...
- 10
- 302
- 0
Báo cáo hóa học: " Research Article A Sociability-Based Routing Scheme for Delay-Tolerant Networks" doc
... extra nodeswhose paths are optimized based on a delay constraint. In[14], cars act as data mules and employ a carry-and-forwardparadigm to transfer data packets to a portal. Finally, in [15],opportunistic ... delay-tolerant applications. A variety of measurements have been made recentlyavailable on the Internet [3, 26] in the form of traffictraces or contact patterns. When a historical database ofcontacts ... the formalizationof a sociability concept and a guideline to its exploitation for efficient forwarding in DTNs. Additionally, a framework for its evaluation and comparison with other schemes is alsopresented.In...
- 13
- 367
- 0
Báo cáo sinh học: " Research Article A Baseband Signal Processing Scheme for Joint Data Frame Synchronization and Symbol Decoding for RFID Systems" docx
... Viterbi algorithmis extended to a group of two substates, including a dilated and a shrunk substate, each of which corresponds to a variant FM0 baseband signal. These variant FM0 baseband signals are ... 5, and then the transmitted waveform is the product of these baseband data symbols and a square wave at M times the symbol rate. The value M is specified in the Query commandthat initiated the associated ... sectionproposes a maximum likelihood sequence estimation-based(MLSE-based) algorithm for joint data detection, symbol boundary self-calibration, and signal frame synchronization. This algorithm can optimally...
- 11
- 359
- 0
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... functional characterization of an insulin- binding protein in invertebrates. We haveidentified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Igdomains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have notrevealed a functional insulin- binding protein so far.Here, we report the identification of the secreted protein Imp-L2 as a ... to search for negative regulators of IIS in Drosophila. Our approach led tothe identification of Imp-L2 as a functional insulin- binding protein and antagonist of IIS.Imp-L2 encodes a secreted...
- 11
- 345
- 0
Báo cáo sinh học: "TBP2 is a general transcription factor specialized for female germ cells" doc
... ovary in anamniotes [4,7].MinireviewTBP2 is a general transcription factor specialized for female germ cellsFerenc Müller* and Làszlò Tora†Addresses: *Department of Medical and Molecular ... initiation of transcription by RNA poly-merase II (Pol II) is central to any developmental process. A key regulatory step in eukaryotic transcription initiation is the assembly of basal transcription ... mRNA is produced maternally and seems to be prevented from being translated in the oocyte and the early embryo. To achieve factor switching, the maternal TBP mRNA trans lation is activated...
- 4
- 235
- 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgagG K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaaFigure 3 Full-length cDNA and deduced protein of CcGCC1 gene. Start and stop codons are underlined. ... I P Q 541 ctttacatgaaaatgagcatgcaaataagagaggcacttcaattgcagctagaactcgagL Y M K M S M Q I R E A L Q L Q L E L E 601 aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaaK H L H D Q L...
- 14
- 400
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM