Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

... functional characterization of an insulin- binding protein in invertebrates. We haveidentified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Igdomains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have notrevealed a functional insulin- binding protein so far.Here, we report the identification of the secreted protein Imp-L2 as a ... to search for negative regulators of IIS in Drosophila. Our approach led tothe identification of Imp-L2 as a functional insulin- binding protein and antagonist of IIS.Imp-L2 encodes a secreted...

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... 24 h before virus inoculation. Bronchoalveolar lavage (BAL) and serum sampleswere obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplexassay (Beadlyte ... review, and MBR per-forming experiments; JC Luminex data analysis and inter-pretation. PK and HSJ data interpretation; OR projectdesign, experimental analyses and interpretation, manu-script ... antibody, MEDI-5 07, at the same time of the administration of the anti-RSV antibody had no effecton the cytokine profile or other clinical and inflammatoryparameters evaluated, therefore those controls...

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

... TGCAGCTTCAAGTAGGCTGAGGAA3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-GATTTCCCGC 3’ ). For each pair of primers, thefollowing protocol was applied. Initial ... in malignant and benign prostate tissue. A: Immunohistochemicalstaining of periostin in PCa and BPH. Negative epithelial and stromalperiostin expression in BPH (a) and PCa(c). Positive epithelial and ... typical signalsequence, a cysteine- rich domain, a fourfold fasciclin 1-like (FAS-1) domain and a C-terminal domain[1,2].TheFAS-1 domain, an evolutionarily ancient adhesiondomain, also exists...

Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

... aassssoocciiaattiioonn mmaappppiinngg??Both methods have advantages and disadvantages. Linkage mapping,particularly in controlled crosses (asopposed to, say, human families), hasthe advantage of increased power ... the rapid identification of large numbers of polymorphisms in parental strains used in linkage-mapping studies, or a sample of individuals from a populationtargeted for association mapping, and several ... for high-resolution mapping in theorganism of interest, and for a way of genotyping these markerseconomically and in parallel in tens of thousands of individuals. Next-generation sequencing methods makepossible...

Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

... CSIC-Universidad de Valladolid, Spain2 Program of In ammation, In ammatory and Infectious Disease Center, and Program of Signal Transduction, Burnham Institute for MedicalResearch, La Jolla, CA, USA3 ... Inc. (Santa Cruz, CA, USA), anti-cullin 3 wasfrom Abcam (Cambridge, UK), and mAbs against b-actin,PHA, FLAG M2 mAb and PMA were from Sigma ChemicalCo. (St Louis, MO, USA). Antibodies against ... zinc ﬁnger) domain is a protein protein interaction domain ﬁrst described in severalproteins of Drosophila melanogaster and poxvirus [1,2].BTB ⁄ POZ domain-containing proteins constitute a diverse...

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

... roles in initial evaluation and staging of patients, ART initiation, and patient monitoring [3].As nurses are becoming increasingly central points of con-tact for clinical care of people living ... text-books and teaching materials and little classroom space),variable quality of teaching with few classroom instructorsprepared to educate, and few clinical instructors and sitesavailable for clinical ... training at the pre-service level to carry out this important work.Methods: To address this issue, the Ministry of Health and Population collaborated with the InternationalTraining and Education...

báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

... exert and maintain an efforttowards attaining organizational goals [9].Although it is likely that motivation influences perform-ance directly and mediates or modifies the effect of inter-ventions ... Survival in Uganda. International Journal of Health Planning and Management2003, 18:329-342.33. Krogstad U, Hofoss D, Veenstra M, Hjortdahl P: Predictors of jobsatisfaction among doctors, nurses and ... group-Table 3: Factor analysis of the 10-item motivation index (rotated factor loadings and unique variances)Variable Factor 1: Organizational commitment Factor 2: Job satisfaction Factor 3:...

Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx

... needed a substantial revisionto allow a clear-cut interpretation of our findings. Asstated in the results section, hypoxia per se induces i)down-regulation of miRNA-44 9a/ b and also miRNA-51 8a- 3p ... Bock.Oliver@MH-Hannover.de1Institute of Pathology, Hannover Medical School, Carl-Neuberg-Strasse 1,30625 Hannover, GermanyFull list of author information is available at the end of the articleMuth et al. Journal of Translational ... down-regulation of miRNA-44 9a/ b under hypoxia. All calculations were performed relative to RNU48 in the cell line F-18. Mean, minimum and maximum values are shown.Re-evaluation of SERPINE1 mRNA expression...

Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

... cells in acute renal injury: ca ira. Curr OpinPharmacol 2006, 6(2):176-183.12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K,Ishida H, Shimizu T, Kangawa K, et al: Monolayered ... tra nsplantation has been used in clinical trials and animal models to treat musculoskeletalinjuries, improve cardiac function in cardiovasculardis eas e and ameliorate the severity of graf t-versus-host-disease ... 2003,13(9):2129-2141.36. Thomas PD, Kejariwal A, Guo N, Mi H, Campbell MJ, Muruganujan A, Lazareva-Ulitsky B: Applications for protein sequence-function evolutiondata: mRNA /protein expression analysis and coding SNP...

Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

... following primers were used:bcl-2 forward 5’ -GTGAACTGGGGGAGG ATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’ ;GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and reverse 5’ -TTACTCCTTGGAGGCCATGT-3’ ... Baldi A: Patterns of tumor response in canine and feline cancerpatients treated with electrochemotherapy: preclinical data for thestandardization of this treatment in pets and humans. J Transl ... this article as: Spugnini et al.: Electroporation increases antitumoralefficacy of the bcl-2 antisense G3139 and chemotherapy in a humanmelanoma xenograft. Journal of Translational Medicine...

Xem thêm

Từ khóa: báo cáo khoa học sinh học trạng thái hiện sinh báo cáo khoa học báo cáo sinh thái học báo cáo trường học thân thiện học sinh tích cực mẫu báo cáo trường học thân thiện học sinh tích cực Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP