0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

Báo cáo hóa học:

Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

... subbands2, 3, and 4, resp.), three cases with two subband corruption (a ecting subbands 2 and 3, 3 and 4, and 4 and 5, resp.), and two cases with three subband corruption (a ecting subbands2, ... identification. The new model estimates the order on a frame-by-frame basis and canbe applied to a single-state HMM or GMM. The model is de-fined in (13 )and( 14), and uses subband features to model speech ... used a full-band feature vector of the samesize (12 MFCC plus 12 delta MFCC) for each frame, with the same band limitation and cepstral mean subtraction. Allmodels used 32 Gaussian mixtures with...
  • 12
  • 323
  • 0
báo cáo hóa học:

báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

... regular hospital bedhas been modified to hold a pneumatic force actuator, a flat friction free surface that supports a back pack frame with air bearings, a visual surround system and a portableair-compressor. ... wear a backpack frame that is freely moving on air-bearings (cf. puck on an air hockeytable) and attached through a cable to a pneumatic cylinder that provides a load that can be set to emulatevarious ... wears a back-pack frame with air-bearings allowing friction free medi-olateral motion. The frame is attached to a weight stack that provides a gravity-like load that the subject must balance against....
  • 7
  • 475
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Nonexpansive Matrices with Applications to Solutions of Linear Systems by Fixed Point Iterations Teck-Cheong Lim" docx

... columns are all equal to x. For A ∈ Mn, ρ A denotesthe spectral radius of A. Let |·|be a norm in Cn. A matrix A ∈ Mnis a contraction relative to |·|if it is a contraction as a transformation ... necessity part of b.IfA has an eigenvalue λ with |λ| > 1and eigenvector v, then as shown above A kv →∞as k →∞.IfA has 1 as an eigenvalue and index1 ≥ 2, then there exist nonzero vectors v1,v2such ... part a .Suppose that A satisfies the conditions in b and that A  SJS−1is the Jordancanonical form of A. Letλ be an eigenvalue of A and let v be a column vector of Scorresponding to λ.If|λ|...
  • 13
  • 291
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article On the Use of Complementary Spectral Features for Speaker Recognition" pot

... Seattle, Wash, USA, May 1998.[16] R. E. Yantorno, K. R. Krishnamachari, J. M. Lovekin, D. S. Ben-incasa, and S. J. Wenndt, “The spectral autocorrelation peakvalley ratio (SAPVR) a usable speech ... specifically, AWGN, babble noise, and bandpass fil-tering (300 Hz–3.4 kHz with a 1 dB bandpass ripple) wereindividually and simultaneously applied to the speech sig-nals to simulate the identification ... MFCC and ΔMFCC fea-tures will be extracted from each speech frame and appendedtogether to form a combined feature vector for each speech frame. Equation (9) shows the feature matrix that can...
  • 10
  • 361
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx

... solution to navigation in GPS signal degraded areas?. Geomatica. 59(2), 175–182(2005)6. M Kourogi, T Ishikawa, Y Kameda, J Ishikawa, K Aoki, T Kurata, Pedestriandead reckoning and its applications, ... layout map matrix adequate forour simulation environment. The walls are depicted inblack, not easily reachable forest area is marked with dark gray, and flowerbed areas are drawn in light gray.Theareawherepeoplemaywalkisdrawninwhite.Inaddition, ... the authorsapply a backtracking PF, where the state estimates arerefined based on particle trajectory histories. A Back-tracking PF recalculates the previous state estimationwithout invalid...
  • 14
  • 488
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Cascaded Linear Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" pdf

... propose a cascaded linear model forjoint Chinese word segmentation and part-of -speech tagging. With a character-basedperceptron as the core, combined with real-valued features such as language models, ... at the same time, we expand boundarytags to include POS information by attaching a POS to the tail of a boundary tag as a postfix followingNg and Low (2004). As each tag is now composedof a ... ateach predication position, which evokes a potentialrisk to depress the training. To alleviate the drawbacks, we propose a cas-caded linear model. It has a two-layer architec-ture, with a...
  • 8
  • 445
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Discriminative Language Model with Pseudo-Negative Samples" pptx

... Arbor,Michigan, June.Brian Roark, Murat Saraclar, and Michael Collins. 2007.Discriminative n-gram language modeling. computer speech and language. Computer Speech and Lan-guage, 21(2):373–392.Roni ... discrimi-native language model using pseudo-negative exam-ples. We also showed that an online margin-basedlearning method enabled us to use half a million sen-tences as training data and achieveaccuracy ... and not all relevant features can be included. A discriminative language model (DLM) assigns a score to a sentence , measuring the correct-ness of a sentence in terms of grammar and prag-matics,...
  • 8
  • 315
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A hybrid rule/model-based finite-state framework for normalizing SMS messages" pot

... Computational Approaches to Linguistic Creativity, pages 71–78.Louise-Amélie Cougnon and Richard Beaufort. 2009.SSLD: a French SMS to standard languagedictionary. In Sylviane Granger and Magali ... is an FST corresponding to the list ofseparators (any non-alphabetic and non-numeric character), mapped onto a SEPmarker.3Actually, the true complement of I accepts sequences with separators, ... etal. (2007) implemented the noisy channel through a Hidden-Markov Model (HMM) able to handleboth graphemic variants and phonetic plays asproposed by (Toutanova and Moore, 2002), whileCook and...
  • 10
  • 379
  • 0
báo cáo hóa học:

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... ShimadaK, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone-marrow cells: a pilot study and a randomised controlled trial.Lancet ... 360(9331):427-435.14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M,Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take-shita S: Unblinded pilot study of autologous transplantation ... pathological neovascularization. Circ Res1999, 85(3):221-228.13. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S,Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, ShimadaK,...
  • 9
  • 773
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttataSElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaaSElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaacSeo ... (’ 5to3 ’)SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaataSED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaataSEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaataSEG ... gcgcggatcctcaagttgtgtataaataSEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaagaSEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacataSElM AF285760 cgcacatatggatgtcggagttttgaat...
  • 9
  • 568
  • 0

Xem thêm

Từ khóa: bao cao hoa bai phan tich dinh tinh cac nguyên tố trong một hợp chat huu codevelopment of a design of experiment methodology applications to the design and analysis of experiments mayasari lim and athanasios mantalarisbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quottuyên tập cac bao cao khoa học hội nghị khoa học địa i apos aBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP