0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot

Báo cáo hóa học:

Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot

... remote attacker in MANETs. In this paper, we proposed a zone sampling-based traceback (ZSBT) algorithm for tracing DoS attackers in MANETs. In our algorithm, when a node forwards a packet, the node ... arbitrarily, which makesattack paths change frequently. Therefore, additional con-straints are placed on tracing approaches for locating theattack sources in time. Therefore, the traceback approaches8 ... attacks typi-cally involve eavesdropping of data. Active attacks involve ac-tions such as replication, modification, and deletion of ex-changed data or DoS attacks. This kind of attacks alwaystarget...
  • 9
  • 657
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article Novel Heuristics for Cell Radius Determination in WCDMA Systems and Their Application to Strategic Planning Studies" potx

... to take into account, fast fadingmargin, log-normal fading margin, and the interferencemargin, Mi. This interference margin is a very relevant value,because it measures the maximum interference ... giving encouraging results. An analytical algorithm is also proposed and compared with the iterativeheuristic. Finally, a combination of both algorithms is alsotested, where the analytical approach ... 2140Common parametersLog normal fading margin (dB) 7.3 Fast fading margin (dB) 2UL intercell interference ratio 0.88 Soft handover gain 3DL intercell interference ratio 0.88 Interference margin (dB)...
  • 14
  • 353
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

... was amplified by tworounds of PCR using semi-nested primers. The primer setBG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) andBG2 (AATAACCTTATCCTCCTCTATAAAATAACC)were used in the first round and BG2 and ... DeSimone1,2AbstractBackground: S110 is a novel dinucleoside analog that could have advantages over existing DNA methyltransferase(DNMT) inhibitors such as decitabine. A potential therapeutic role for ... can elevate fetal hemo-globin have great potential as therapeutic agents. TheDNA methyltransferase (DNMT) inhibitors 5-azacytidineand 5-aza-2’deoxycyidine (decitabine) have been shown toincrease...
  • 8
  • 443
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Medusa: A Novel Stream-Scheduling Scheme for Parallel Video Servers" ppt

... Gi. For each logical request group, a parallel video server maintains a stream informa-tion list. Each element of the stream infor mation listrecords the necessary information of a patching ... have very similar balancing results [24]. However,the random placement scheme only provides probabilisticguarantee of load balancing and it has the drawback of main-taining a huge video index ... in International Parallel and Distributed ProcessingSymposium, pp. 15–19, Fort Lauderdale, Fla, USA, April 2002.[23] S. Wu, H. Jin, and G. Tan, “Analysis of load balancing issuescaused by intra-movie...
  • 13
  • 213
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Noninvasive positive pressure ventilation for acute respiratory failure in children: a concise review" potx

... pressureventilation for bilateral diaphragm paralysis after pediatric cardiacsurgery. Interact Cardiovasc Thorac Surg 2009, 8:171-172.30. Chin K, Uemoto S, Takahashi K, Egawa H, Kasahara M, Fujimoto ... failure can be lifesaving. Mechanical respiratory support is a critical intervention in many cases of ARF. In recent years, NPPV has been proposed as a valuable alternative to invasive mechanical ventilation ... The EPAP deliv-ered by NPPV may help to decrease dynamic hyperinfla-tion by maintaining small airway patency and mayreduce the patient’s work of breathing by decreasing thedrop in alveolar pressure...
  • 10
  • 484
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Adaptive Algorithm for Chirp-Rate Estimation" pot

... question in the algorithm is how toestimate σ(hi) since the signal amplitude and noise variance (A and σ) are not known in advance. There are severalEURASIP Journal on Advances in Signal Processing ... important feature of nonstationary signals in numerous applications suchas radar, sonar, and communications. In this paper, an adaptive algorithm for the chirp-rate estimation is proposed. It is basedon ... expressions for the bias and the vari-ance of the nonparametric chirp-rate estimate are providedas a prerequisite for the proposed adaptive algorithm. Fulldetails of the adaptive algorithm based...
  • 9
  • 261
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Measurement Combination for Acoustic Source Localization in a Room Environment" ppt

... SRP-PHAT and MCCC-PHAT have a large evenly distributed like-lihood mass, that is, large variance. Note that only a singletalker was active at a time, and the marginal SLFs are multi-modal due ... aspect of local-ization. Large databases of smart room recordings are avail-able for system evaluations and development [1]. A typi-cal ASL system consists of several spatially separated micro-phones. ... Salt LakeCity, Utah, USA, May 2001.[13] J M. Valin, F. Michaud, and J. Rouat, “Robust localization andtracking of simultaneous moving sound sources using beam-forming and particle filtering,”...
  • 14
  • 298
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Algorithm for Detection of DVB-T Signals Based on Their Second-Order Statistics" doc

... Estimation, and Modulation Theory:Radar-Sonar Signal Processing and Gaussian Signals in Noise—Part III, John Wiley & Sons, New York, NY, USA, 2nd edition,2001.[12] A. V. Dandawate and G. B. Giannakis, ... someanalytical results are given. In particular, the noise and multipath channel impacts on its values are theoretically analysed. In a second part of the paper, some asymptotic results are derived. A ... WG has thus been created todevelop an air interface based on an opportunist access in theTV bands. According to their results (see [6, 7]formorede-tails), an opportunist terminal can set a communication...
  • 9
  • 254
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article Iterative Algorithm for Approximating Solutions of Maximal Monotone Operators in Hilbert Spaces" pot

... Tianjin 300160, ChinaEmail address: chenrd@tjpu.edu.cnY. Yao and R. Chen 7we have that A is a maximal monotone operator (see Rockafellar [14, Theorem 3]). Wecan also check that 0∈ Av if and ... Mathematical Programming, vol. 87, no. 1, pp. 189–202, 2000.[7] S. Kamimura and W. Takahashi, “Approximating solutions of maximal monotone operators in Hilbert spaces,” Journal of Approximation ... minimization problem of finding a minimizer of a proper lower-semicontinuousconvex function and the variational problem of finding a solution of a var iational in- equality.2. PreliminariesRecall...
  • 8
  • 263
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " ADAM: A Realistic Implementation for a W-CDMA Smart Antenna" docx

... Implementation for a W-CDMA Smart Antenna 1385If capabilities of phased array, switched-beam array, andadaptive array antennas are compared, the last type showsconsiderable advantages over ... synchronization, DSP, UMTS.1. INTRODUCTIONThe smart antenna concept is applied to several kinds of an-tenna arrays. Phased arrays, switched multibeam antennas,and a daptive array antennas are usually ... of an adaptive antenna,named ADAM, that can be used with any standard Node B, both in the up- and downlinks. This transparent operational featurehas been made possible by the partial cancelation...
  • 23
  • 321
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóađề thi cao đẳng môn hóa học khối a năm 2012quảng cáo trên báo giấy hoa học tròđề thi cao đẳng môn hóa học khối a năm 2011Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ