0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học:

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... R−1η−R−1ηS(P−1)(SH(P−1)R−1ηS(P−1))−1SH(P−1)R−1ηat the beginning of each step, that is, at the beginning of the line search for a de-lay parameter. Without taking into consideration the blockdiagonal form of Rη, as well as the order ... which naturally exploits multipath channel parame-ters.5. CONCLUSIONS In this paper, a new method for estimating the multipath channel parameters of a single user in the uplink of a DS-CDMA system ... 47938, Pages 1–12DOI 10.1155/WCN/2006/47938 A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA SystemVassilis Kekatos,1Athanasios A. Rontogiannis,2and...
  • 12
  • 438
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... LactobacillusreuteriHema Vaidyanathan1, Vijayalakshmi Kandasamy1, Gopi Gopal Ramakrishnan1, KB Ramachandran2,Guhan Jayaraman2and Subramanian Ramalingam1*Abstract In this work, Lactobacillus reuteri has ... levelsbeing 25% lesser than that of the native strain. Interestingly, the recombinant strain exhibited elevated rates of lactate and ethanol formation as well as reduced rate of acetate production, ... ramabioprocess@annauniv.edu1Centre for Biotechnology, Anna University, Chennai 600 025, Tamil Nadu,IndiaFull list of author information is available at the end of the articleVaidyanathan et al. AMB Express 2011,...
  • 8
  • 399
  • 0
báo cáo hóa học:

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3'MCP-5: GenBank Accessions # AC012294, NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal ... Accession#AY357296, 2946nt 5'-AAGCAGACGTGGTAC-CCACAGTCTTGCTTTAACGCTACTTTTCCAAGATAAGGTGACTCAGAAAAG-GACAAGGGGTGAGCCCAACCACACAGCTGCT-3'3043nt) was PCR-amplified from genomic DNA isolatedfrom ... carrying the wild-type sequence was sequenced to confirm accuracy. A mutant sequence (5'-AAGCAGATTTGGTACCCT-TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGTGACTCAGAAA AGGACAAGGG GTGAGCCCAACCACAAGGCTGCT-3')...
  • 15
  • 541
  • 0
báo cáo hóa học:

báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

... kkucharo@sanfordburnham.org1Sanford-Burnham Medical Research Institute, La Jolla, CA 92037, USAFull list of author information is available at the end of the articleKucharova et al. Journal of Neuroinflammation 2011, ... T-3’;IL-4 forward 5’-AGG TCA CAG GAG AAG GGA CGC C-3’IL-4 reverse 5’-TGC GAA GCA CCT TGG AAG CCC-3’IL-10 forward 5’-CTG GAC AAC ATA CTG CTA ACC G-3’IL-10 reverse 5’-GGG CAT CAC TTC TAC CAG GTA A- 3’IL-1b ... 10sections, and all 20 values were then summed to obtain the total volume of demyelination. For animals of the same genotype and s urvival period, an average volume of demyelination was obtained and...
  • 13
  • 480
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Turbo Processing for Joint Channel Estimation, Synchronization, and Decoding in Coded MIMO-OFDM Systems" pdf

... with a preamble that contains known training sequences to facilitate the init ial synchronization and channel estimation. However, the insufficient accuracy of initially estimated CFO, SFO,and channel ... transmit-receive antennapair, we consider an exponentially decaying Rayleigh fading channel with a channel length of 5 and a RMS delay spread of 50 nanoseconds. In the simulation, the channel impulseresponses ... parameter. (The use of a scaled identity matrix for initialization is mainly for convenience, and a random initial-ization matrix can also be employed. Since convergence willinvariably be attained,...
  • 12
  • 325
  • 1
báo cáo hóa học:

báo cáo hóa học: " Robot-assisted reaching exercise promotes arm movement recovery in chronic hemiparetic stroke: a randomized controlled pilot study" pptx

... tocomplete tasks on the Rancho Los Amigos Functional Test(Table 2).Statistical analysisAn initial statistical analysis was made using a doublymultivariate repeated measures analysis of variance(ANOVA), ... needed. In fact, comparisons of therapeutic approaches incorpo-rating some form of clinician assistance have revealed dif-fering rates of motor recovery and cortical reorganization in a subacute ... Rehabilitation and Measurement (ARM) Guide. A motor (M) actuates a hand piece and forearm trough (T) attached to a user's arm (A) back and forth along a linear track. A six-axis force sensor...
  • 13
  • 396
  • 0
báo cáo hóa học:

báo cáo hóa học:" New fluoroscopic imaging technique for investigation of 6DOF knee kinematics during treadmill gait" pot

... the limited field of view of the imageintensifier. They estimated an accuracy of 0.2 mm for in- plane translation and of 3.25 mm for out-plane transla-tion and an accuracy of 1.57° for rotation ... lower than that of the treadmill. Flexion amplitudesincreased with increasing walking speed. Motion patterns in other DOF were not affected byincrease in walking speed. The motion character was ... phasefrom heel strike to toe-off. The average speed of the knee during stance phase was cal-culated by dividing the maximal traveling distance by the corresponding traveling time. The data...
  • 5
  • 308
  • 0
báo cáo hóa học:

báo cáo hóa học:" Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" ppt

... and infant samples. Two independent infections were conducted with each sample in duplicate (4 replicates) for each of 43 maternal and 45 infant plasma. Maternal and infant plasma significantly ... percent change (increase or decrease) in p24 antigen of the maternal or infant plasma from the mean of the seronegative samples was calculated. Neutral-ization was defined as 70% or greater reduction ... assigned.Correlation between maternal and infant p24 antigen levels and maternal viral load with maternal and infant p24 antigenUsing Spearman's correlation, we examined the associa-tion between maternal...
  • 10
  • 437
  • 0
báo cáo hóa học:

báo cáo hóa học:" Progressive obesity leads to altered ovarian gene expression in the Lethal Yellow mouse: a microarray study" pptx

... in microarray analyses. KE performed RNA extractions andmicroarray analyses, and performed statistical analyses onmicroarray data. JB performed final data analysis anddrafted the manuscript. All authors ... the cRNA and washed again. An Axon Gene-Pix Scanner was used to scan the microarrays. GenePix Prosoftware (MDS, Inc., Toronto, ON) was used to acquireand align the microarray image. CodeLink ... contaminat-ing genomic DNA. Total RNA was eluted from the col-umn. The RNA concentration and purity were calculatedusing the RNA 6000 Nano LabChip in an Agilent Bioana-lyzer. The RNA was stored...
  • 9
  • 346
  • 0
báo cáo hóa học:

báo cáo hóa học:" HIV-related restrictions on entry, residence and stay in the WHO European Region: a survey" ppt

... required for foreigners applying for residence or a work p ermit. In the German s tate of Bavaria, an HIV test can be required for people staying for more than 180 days, while in the states of Saxonyand ... influenza virus A (H1N1). Together with international organizations, suchas the International AIDS Society (IAS) [10], t he Inter-national Organization for Migration and the Joint Uni-ted Nations ... Group (EATG) and the IAS. The infor-mation in this database is based on replies to a struc-tured self-administered questionnaire from Germanembassies abroad and foreign embassies in Germanybetween...
  • 6
  • 401
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròwhat is the role of mass communication in the development of a countryBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP