Báo cáo nghiên cứu khoa học " Mango Postharvest Manual - Version 1" pptx

... green mango fruit Impact damage of ripe mango fruit CARD Project 05004 VIE Improvement of Vietnamese Postharvest Practices and Supply Chains - July 2007 Postharvest Physiology Training Manual ... fruit) Eg. Mango Non-climactericEg. Orange CARD Project 05004 VIE Improvement of Vietnamese Postharvest Practices and Supply Chains - July 2007 Postharvest Physiology Training Manual Page ... availability of fresh produce out-of-season. CARD Project 05004 VIE Improvement of Vietnamese Postharvest Practices and Supply Chains - July 2007 Postharvest Physiology Training Manual Page 355.11 Black...

Báo cáo nghiên cứu khoa học " Evolution of Evolution of IPM " pptx

... and practiceand practice - - Selective exposure.Selective exposure. - - Selective perception.Selective perception. - - Selective attentionSelective attention - - Selective retention.Selective ... we have!Carrying out preCarrying out pre - - test by test by ““KAPKAP””survey survey (Knowledge(Knowledge - - AttitudeAttitude - - Practice).Practice).Data analysis by Data ... keeping for natural enemies Weed keeping for natural enemies habitathabitat...

Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS2" pdf

... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Organisation Research Institute of Fruits and Vegetables (RIFAV), ... each of the RIFAV-Hanoi and IAS-HoChiMinh. The aims of this experiment in Year 1 were evaluation of Vietnam’s coir dust in greenhouse systems. • Experimental trial in IAS-Hochiminh: Trial ... Australia from 31st October to 27th November, 2005 for a 4- week course of focussed on the Best practices for vegetable production, Postharvest management skills in supply chain mapping, Good...

Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS3 " pot

... Media 1 - Sugar cane waste & peanut husk & soybean • Media 2 - Sugar cane waste & peanut husk & peat • Media 3 - Sugar cane waste & peat & volcanic rock • Media 4 - Cocopeat ... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Organisation Research Institute of Fruits and Vegetables (RIFAV), ... AusAID-CARD project (0016) focussed on development of a low-tech greenhouse system to enhance the productivity and sustainability of the Vietnamese vegetable industry. The nethouse with run-to-waste...

Báo cáo nghiên cứu khoa học " Improving the safety and quality of Vietnamese vegetables through research and capacity building in quality assurance, postharvest management and high technology protected cropping systems - MS6 " pptx

... grown in both mixes (Fig. 2). 0200004000060000800001000001200002-Jul 12-Jul 22-Jul 1-Aug 1 1- Aug2 1- Aug3 1- Aug10-SepDate of harvestTotal water used (ml)Mix 1Mix 2Poly. (Mix 1)Poly. ... graham.denney@dpi.nsw.gov.au In Vietnam Name: Associate Prof Dr Tran Khac Thi Telephone: 8 4-4 -8 276316 Position: Deputy Director Fax: 8 4-4 -8 276148 Organisation Research Institute of Fruits and Vegetables (RIFAV), ... AusAID-CARD project (0016) focussed on development of a low-tech greenhouse system to enhance the productivity and sustainability of the Vietnamese vegetable industry. The nethouse with run-to-waste...

Báo cáo nghiên cứu khoa học " REPORT ON INVESTIGATIONS INTO MANGO SUPPLY CHAINS IN THE MEKONG DELTA VIETNAM 2005-2007 " ppt

... January 2008 Page 33 Mango variety 'Ghep'Thousands ('000) VND / kg<3 3-5 5-1 0 1 0-1 5 1 5-2 0 2 0-2 5 2 5-3 0 >30Percentage (%) of the total number of mango retaliers surveyed0102030405060 ... the mango cultivar ‘‘Cat Hoa Loc’’ in Ho Chi Minh City, Vietnam Off Season (Mango Cultivar 'Cat Hoa Loc')Thousands ('000) VND / kg<3 3-5 5-1 0 1 0-1 5 1 5-2 0 2 0-2 5 2 5-3 0 ... Page 31Main Season (Mango variety 'Cat Ho Loc')Thousands ('000) VND / kg<3 3-5 5-1 0 1 0-1 5 1 5-2 0 2 0-2 5 2 5-3 0 >30Percentage (%) of the total number of mango retaliers surveyed01020304050...

Báo cáo nghiên cứu khoa học " Cat Hoa Loc Mango Quality Guide " ppt

... improved post-harvest and supply chain management By R. J. Nissen, Nguyen Duy Duc & Dr Nguyen Minh Chau et. al. 2008 Page 31 Class 2 Sub-class A Class 2 Sub-class B Class 2 Sub-class C ... Hoa Loc Mango Variety Cat Chu Mango Variety Buoi / Ghep Mango Variety CARD Project 050/04 VIE “Improvement of export and domestic markets for Vietnamese fruit through improved post-harvest ... Vietnamese fruit through improved post-harvest and supply chain management By R. J. Nissen, Nguyen Duy Duc & Dr Nguyen Minh Chau et. al. 2008 Page 5 Mango fruit :- mango structure Description ...

Báo cáo nghiên cứu khoa học " Fruit Quality Characteristics for Pomelo and Mango to develop quality guides for the Vietnamese pomelo and Mango Industries " docx

... 7SOFRI Trials on Hot Water Fungicide Treatment of Mango Cat Ho Loc By Mr Do Minh Hien Sap and extraneous matter was removed via washing. Cleaned mango fruit of the cultivar “Cat Hoa Loc” are ... “Cat Hoa Loc” are presented in Figure 1 below. Figure 1. Cleaned Fruit of the Mango cultivar “Cat Hoa Loc Mango Fruit were placed in a hot water fungicide dip of carbendazim for 5 minutes ... fruit were not affected by Anthracnose but some skin scalding was evident (Figure 4). Cleaned mango fruit were still affected by Anthracnose (Figure 5). Control treatment fruit had the highest...

Báo cáo nghiên cứu khoa học cuối kỳ

... chức năng nghiên cứu : 6 Phân loại theo tính chất của sản phẩm nghiên cứu : 6 LÀM THẾ NÀO ĐỂ NGHIÊN CỨU KHOA HỌC ĐẠT HIỆU QUẢ 8 Trình tự các bước cần tiến hành trong nghiên cứu khoa học 8 Các ... hướng. Nghiên cứu cơ bản định hướng được phân chia thành nghiên cứu nền tảng (background research) và nghiên cứu chuyên đề (thematic research). Nghiên cứu nền tảng, là những nghiên cứu về ... tạo khoa học Trang 15tham khảo, không phải kết quả của nghiên cứu này và cũng là cách tôn trọng những nghiên cứu trước.Ứng xử có đạo đức trong nghiên cứu Có những điều nếu người nghiên cứu...

56
2,778
6

Báo cáo nghiên cứu khoa học

... hiện DNA-A của nhiều begomovirus (Ha et al., 2006, 2008)Hai cặp mồi còn lại là các mồi đặc hiệu cho TYLCVNV (TYLCVNV-sp-F1 / TYLCVNV-sp-R1) và ToLCVV (ToLCVV-sp-F2 / ToLCVV-sp-R2). ... được sử dụng trong nghiên cứu Mồi Trình tự (5’ – 3’) Vị tríKích thước (bp)Tham khảoTYLCVNV-Sp-F1TGTGTTACATATTCTGTGTTTTCC 109 4-1 1171386Mã GeneBank DQ641697TYLCVNV-Sp-R1AAATACATCAAAATCTGCAGAGAGC245 6-2 480ToLCVV-Sp-F2 ... DQ641697TYLCVNV-Sp-R1AAATACATCAAAATCTGCAGAGAGC245 6-2 480ToLCVV-Sp-F2 GACCAGTCTGAAGGTGTGAGTTC 125 4-1 276454Mã GeneBank DQ641705ToLCVV-Sp-R2ACTCAAGCTATAAAGAATACCTAGAC168 3-1 708BegoAFor1TGYGARGGiCCiTGYAARGTYCARTC*Hình...

Xem thêm