Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... descent method for common solutions of generalized mixed equilibrium problems and fixed point problems Nawitcha Onjai-uea1,3, Chaichana Jaiboon2,3* and Poom Kumam1,3* Correspondence: chaichana.j@rmutr.ac.th2Department ... chaichana.j@rmutr.ac.th2Department of Mathematics,Faculty of Liberal Arts, RajamangalaUniversity of TechnologyRattanakosin (Rmutr), Bangkok10100, ThailandFull list of author information ... doi:10.1016/j.na.2008.02.04210. Chantarangsi, W, Jaiboon, C, Kumam, P: A viscosity hybrid steepest descent method for generalized mixed equilibrium problems and variational inequalities, for relaxed cocoercive...
- 20
- 350
- 0
Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt
... P. Katchang and P. Kumam, A general iterative method of fixed points for mixed equilibrium problems and variational inclusion problems, ” Journal of Inequalities and Applications, vol. 2010, ArticleID ... Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for StrictlyPseudocontractive MappingsThanyarat Jitpeera and Poom KumamDepartment of Mathematics, ... paper, motivate, by Tada and Takahashi 26, Qin and Kang 27,andKumam and Jaiboon 28, we introduce a new shrinking projection method for finding a common element of the set of fixed points of...
- 25
- 495
- 0
Báo cáo hóa học: " Research Article Hybrid Steepest Descent Method with Variable Parameters for General Variational Inequalities Yanrong Yu and Rudong Chen" pptx
... Nonlinear Functional Analysis and Its Applications. III: Variational Methods and Opti-mization, Springer, New York, NY, USA, 1985.[11] I. Yamada, “The hybrid steepest- descent method for variational ... The-ory and Applications, vol. 79, no. 1, pp. 197–206, 1993.[7] Y. Yao and M. A. Noor, “On modified hybrid steepest- descent methods for general variationalinequalities,” Journal of Mathematical Analysis ... known that a wide class of problems arising in various branches of pure and appliedsciences can be studied in the general and unified framework of variational inequalities.Several numerical methods...
- 14
- 232
- 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx
... Surface area of thecatalyst before and after use in the reaction was mea-sured using surface area & pore size analyzer (NOVA1000e, Quanta chrome Instruments). All the chemicalswere used as-received.5. ... theyare cheap in general, commercially available, air stable crystalline solids, safe, and non-toxic, hence easy to handle.Results: Carbonyl compounds (aliphatic, heterocyclic, and aromatic) ... chemistryLakhinath Saikia1, Jejiron Maheswari Baruah2 and Ashim Jyoti Thakur1*AbstractBackground: Synthesis of oximes is an important reaction in organic chemistry, because these versatile...
- 6
- 591
- 1
Báo cáo hóa học: " Research Article Hybrid Viscosity Iterative Method for Fixed Point, Variational Inequality and Equilibrium Problem" pot
... “Viscosity approximation methods for nonexpansive mappings,” Journal of MathematicalAnalysis and Applications, vol. 298, no. 1, pp. 279–291, 2004.9 P. L. Combettes and S. A. Hirstoaga, Equilibrium ... and W. Takahashi, “Viscosity approximation methods for equilibrium problems and fixed point problems in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol. 331, no.1, pp. ... “Strong convergence of Krasnoselskii and Mann’s type sequences for one-parameter non-expansive semigroups without Bochner integrals,” Journal of Mathematical Analysis and Applications,vol. 305,...
- 13
- 244
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx
... effective-ness of the method for diameter measurement. The method is automated, accurate, and much faster than manual method and has the capability of being used as an on-linetechnique for quality control.References1. ... The method was tested by a simulatedimage with known characteristics and a real web. Mean(M) and standard deviation (STD) of fiber diameterobtained using this method for the simulated image ... NANO PERSPECTIVES A New Image Analysis Based Method for Measuring ElectrospunNanofiber DiameterMohammad Ziabari Æ Vahid Mottaghitalab ÆScott T. McGovern Æ A. K. HaghiReceived: 7 August...
- 4
- 296
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" ppt
... automated, accurate, and much faster than manual method and has the capability of being used as an on-linetechnique for quality control.References1. A. K. Haghi, M. Akbari, Phys. Stat. Sol. A 204, ... paper, a new image analysis based method for electrospun nanofiber diameter measurementhas been presented. The method was tested by a simulatedimage with known characteristics and a real web. Mean(M) ... measurement. Automating the fiberdiameter measurement and eliminating the use of thehuman operator is a natural solution to this problem.Image AnalysisAn image analysis based method was proposed...
- 4
- 330
- 0
Báo cáo hóa học: " A Novel Speech/Noise Discrimination Method for Embedded ASR System" pot
... rateModel-basedFilter-based(c)10.90.80.70.60.50.40.30.20.1000.20.40.60.81Probability of error ICorrect rateModel-basedFilter-based(d)Figure 2: Comparison of ROC curves of two methods in each dataset.APPENDIXDERIVATION OF FORMULA (3) For a Gaussian distributionp(x) ... σ2n+1 and µn, σ2nare the mean vector and variancevector after and before updating, respectively, n the number of noise frames before the update, and Nn+1the noise frameto update the ... increases is called a consistent estimator.The mean estimator (A. 2) is also an unbiased and consis-tent estimator . The (A. 3) of the Gaussian distribution wasobtained using MLE. This estimator...
- 6
- 200
- 0
Báo cáo hóa học: " An implicit iterative algorithm with errors for two families of generalized asymptotically nonexpansive mappings" pptx
... ,Agarwal et al. Fixed Point Theory and Applications 2011, 2011:58http://www.fixedpointtheoryandapplications.com/content/2011/1/58Page 8 of 17Author details1Department of Mathematics, Texas ... Plubtieng et al. [14],Qin et al. [15], Thakur [ 21], Thianwan and Suantai [22], Xu and Ori [23], and Zhou and Chang [24] as special cases mainly improves the resul ts of Cianciaruso et al. [9] inthe ... Chang et a l. [6], Chidume and Shahzad [7], Cianciaruso et al. [9], Guo and Cho [10], Khan et al. [12], Plubtieng et al.[14], Qin et al. [15], Shzhzad and Zegeye [18], Thakur [21], Thianwan and...
- 17
- 298
- 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttataSElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaaSElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaacSeo et al. ... (’5to3’)SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaataSED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaataSEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaataSEG ... gcgcggatcctcaagttgtgtataaataSEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaagaSEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacataSElM AF285760 cgcacatatggatgtcggagttttgaat...
- 9
- 568
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật