Báo cáo hóa học: " An international evaluation of ultrasound vs. computed tomography in the diagnosis of appendicitis" doc
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... transmigration of monocytes and macrophages across the BBB to the sites of axonal injury in the brain [33,37]. Both in vitro and in vivofindings suggest that hypoxia/ischemia-induced infiltra-tion of monocytes ... HIF-1-binding sites in the pro-moter regions of MCP-1 and MCP-5 genes. Hypoxia and CoCl2 up-regulate the expression of both HIF-1α and chemokines MCP-1 and MCP-5 in astrocytes. The levels of MCP-5 ... wedemonstrate the role of HIF-1α in hypoxia-induced up -regulation of inflammatory chemokines, human monocyte chemoattractant protein-1 (MCP-1/CCL2) and mouse MCP-5 (Ccl12), in human and mouse astrocytes,...
- 15
- 541
- 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx
... ToxicologyOpen AccessResearch Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approachMartha ... and sootaggregates of the fine fraction indicates a combination of natural and anthropogenic sources influenced by smelterand incineration emissions in the study area. In vitro Generation of ... reactive oxygen and nitrogen species by neutrophils in contact with PM2.5Figure 4 In vitro generation of reactive oxygen and nitrogen species by neutrophils in contact with PM2.5. A. In vitro production...
- 11
- 511
- 0
báo cáo hóa học:" Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" ppt
... assigned.Correlation between maternal and infant p24 antigen levels and maternal viral load with maternal and infant p24 antigenUsing Spearman's correlation, we examined the associa-tion between maternal ... viral loadHIV enhancementAbstractBackground: We examined the association and interaction between maternal viral load and antibodies in vertical transmission of HIV in a non-randomized prospective ... maternal viral load and enhancing activity in vertical transmission of HIV by using mothers' charac-teristics (viral load and p24 antigen value) and the infants'p24 antigen values. A...
- 10
- 437
- 0
báo cáo hóa học:" Reverse shoulder arthroplasty leads to significant biomechanical changes in the remaining rotator cuff" doc
... al.: Reverse shoulder arthroplasty leads to significant biomechanical changes in the remaining rotator cuff.Journal of Orthopaedic Surgery and Research 2011 6:42.Submit your next manuscript to ... betweenmuscle insertion sites of the rema ining rotator cuff afterRSA. During glenohumeral abduction, significant changes were seen in both, the teres minor and the sub-scapularis moment arms. These changes ... componentwas determined to define the centre of rotation in post-operative shoulders. For easy and distinct interpretation in line with clinical practice the following definition forfunctional...
- 7
- 420
- 0
báo cáo hóa học:" How do existing HIV-specific instruments measure up? Evaluating the ability of instruments to describe disability experienced by adults living with HIV" pot
... Disability Framework (contextual factors and triggers of disability) .However, these instruments may possess content thatrelates to the dimensions of disability experienced by adults living with HIV. We only ... over the course of living with HIV. In this paper, we describe the extent to which existing HIV-specific health-status instruments capture the experience of disability for adults living with ... depth of disability asconceptualized by the Episodic Disability Framework, they provide a foundation from which to build a measure of disability for adults living with HIV.Background With longer...
- 10
- 553
- 0
Báo cáo hóa học: " An international evaluation of ultrasound vs. computed tomography in the diagnosis of appendicitis" doc
... States standpoint, participated in the design of the study, performed the statistical analysis, and participated in the drafting of the manuscript. Allauthors read and approved the final manuscript.Competing ... as the first-line test in the case of suspectedappendicitis, and its use is increasing [15,16,20]. In this international study, we compared the perfor-mance of CT and US in the evaluation of ... review and drafted the manuscript. TZ conceived of the study from the Israeli standpoint, participated in the design of the study,and helped draft the manuscript. SW conceived of the study from the United...
- 7
- 451
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
... Lactobacillus reuteriHema Vaidyanathan1, Vijayalakshmi Kandasamy1, Gopi Gopal Ramakrishnan1, KB Ramachandran2,Guhan Jayaraman2and Subramanian Ramalingam1*Abstract In this work, Lactobacillus reuteri has ... doi:10.1007/s00253-010-2678-0.doi:10.1186/2191-0855-1-37Cite this article as: Vaidyanathan et al.: Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri. AMB Express ... 1:37http://www.amb-express.com/content/1/1/37Page 3 of 8ORIGINAL Open Access Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteriHema...
- 8
- 399
- 0
Báo cáo hóa học: " Some new nonlinear integral inequalities and their applications in the qualitative analysis of differential equations" potx
... article as: Zheng and Feng: Some new nonlinear integral inequalities and their applications in the qualitative analysis of differential equations. Journal of Inequalities and Applications 2011 ... doi:10.1016/j.amc.2006.05.013Zheng and Feng Journal of Inequalities and Applications 2011, 2011:20http://www.journalofinequalitiesandapplications.com/content/2011/1/20Page 14 of 15RESEARC H Open Access Some new nonlinear integral ... integral inequalities and their applications in the qualitative analysis of differential equationsBin Zheng1* and Qinghua Feng1,2* Correspondence:zhengbin2601@126.com1School of Science, ShandongUniversity...
- 15
- 430
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... PCRprimersSequenceCapture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGT-3Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTA-3Type-specific ... Open Access A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNAWang Yu-Hong1†, Chen Rui2† and Li Ding3*AbstractBackground: The recent advance in nanomaterial ... clinical samples and part of molecular diagnostic study. LDconceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis. All authors...
- 9
- 469
- 0
Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf
... =76.7(%) of total logic elements. Note that with the limitation of EP2C35F672C6, we cannot evaluate 64-sample case orlarger.In this paper, towards the realization of RRO-NRDPWT-based ECG data compression ... this paper, a modified run-length coding (MRLC) algorithm i s proposed towards the realization of a RRO-NRDPWT-based ECG data compression system. The MRLC with its regularity and low computational ... surface of a body. Since the heart is a three-dimensional organ,heart disease diagnosis usually requires the use of several ECG signals sensed at various positions around the heart. A typical requirement...
- 8
- 394
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3, in the generalized reaction-diffusiontheory 4, in the turbulent flow of a gas in porous medium and in the ... 498–505, 1996.13 A. V. Lair and A. W. Shaker, “Classical and weak solutions of a singular semilinear elliptic problem, ”Journal of Mathematical Analysis and Applications, vol. 211, no. 2, pp. ... Boundary Value Problems16 C. A. Santos, “On ground state solutions for singular and semi-linear problems including super-linear terms at in nity,” Nonlinear Analysis: Theory, Methods & Applications....
- 16
- 438
- 0
báo cáo hóa học:" Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema" doc
... ProcessingVolume 2009, Article ID 203790, 13 pagesdoi:10.1155/2009/203790 Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold EdemaConstantine ... 0.40.45 0.5PFAWithoutrejectoption With reject option Figure 6: Zoom in the experimental ROC curves of the linear classifier applied to vocal fold edema detection in women without reject option (dashed ... 0.0172 and PD= 0.994709, when the reject option is enabled. The superiority of the linear classifier with reject option is demonstrated in Figure 5, where the convex hull of the ROC curves with reject...
- 13
- 365
- 0
Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx
... Nazarpour, S. Sanei, and J. A. Chambers, A novel semi-blind signal extraction approach incorporating PARAFAC for the removal of the removal of eye-blink artifact from EEGs,”in Proceedings of ... measure of performance for the proposed artifact removal method, the CC values of the extracted eye-blink artifact source and the original and the artifact removed EEGs are computed, see Figure 7.ThevaluesreportedinFigure ... Notwithstanding theserecently published semiblind approaches, we propose ananalytic and rational method to acquire the prior informa-tion, that is, the spatial signature of the eye-blink signal, from...
- 12
- 429
- 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... R−1η−R−1ηS(P−1)(SH(P−1)R−1ηS(P−1))−1SH(P−1)R−1ηat the beginning of each step, that is, at the beginning of the line search for a de-lay parameter. Without taking into consideration the blockdiagonal form of Rη, as well as the order ... which naturally exploits multipath channel parame-ters.5. CONCLUSIONS In this paper, a new method for estimating the multipath channel parameters of a single user in the uplink of a DS-CDMA system ... 47938, Pages 1–12DOI 10.1155/WCN/2006/47938 A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA SystemVassilis Kekatos,1Athanasios A. Rontogiannis,2and...
- 12
- 438
- 0
Báo cáo y học: "Nitrogen washout/washin, helium dilution and computed tomography in the assessment of end expiratory lung volume" docx
... dividing the difference in peak inspiratory airwaypressure and the plateau inspiratory pressure, measured dur-ing an end inspiratory pause, by the inspiratory flow preceding the occlusion. The ... of end expiratory lung volume (EELV) measured by the helium dilution technique and the computed tomography (CT) scanComparison of end expiratory lung volume (EELV) measured by the helium dilution ... between the increase of EELV and the differ-ence between the volume measured by the CT scan and the volume measured by the helium dilution technique. Indeed the EELV measured by the helium dilution...
- 8
- 317
- 0
Từ khóa: what is the diagnostic performance of computed tomography in the investigation of ankle fractures in childrencomputed tomography in the workup of patients with penetrating traumabáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóabáo cáo vệ sinh an toàn thực phẩm trong trường họcbáo cáo công tác an ninh trật tự trong trường họcquảng cáo trên báo giấy hoa học tròbáo cáo công tác an toàn giao thông trong trường họcbài tập nâng cao hóa học 10 có đáp ángiáo án lớp 10 nâng cao hóa họcbáo cáo tình hình an ninh trật tự trong trường họctrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ