0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx

báo cáo hóa học:

báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

... 11:1108-11.28. Sadamori N, Mine M, Hakariya S, Ichiba M, Kawachi T, Itoyama T,Nakamura H, Tomonaga M, Hayashi K: Clinical significance of beta 2-microglobulin in serum of adult T cell leukemia.Leukemia 1995, ... 28:115-123.20. Ramalingam TS, Chakrabarti A, Edidin M: Interaction of class I human leukocyte antigen (HLA- I) molecules with insulinreceptors and its effect on the insulin-signaling cascade. MolBiol Cell ... were assigned 0(absent staining), 1 (weak diffuse staining) or 2 (strongdiffuse staining). Each score was an average of the twosamples graded for each individual tumor in the array.Each slide...
  • 13
  • 529
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel asynchronous access method with binary interfaces" doc

... communicate intent with a binary human-machine interface (e.g.,mechanical, gestural or neural switches). Asynchronous access methods are preferable, but havenot been used with binary interfaces ... Access Research A novel asynchronous access method with binary interfacesJorge Silva*1,4, Jorge Torres-Solis1,2,3, Tom Chau2,3 and Alex Mihailidis4Address: 1Komodo OpenLab, Toronto, Canada, ... communicate a particular message through a binary channelFigure 2Sample state sequences fi(t) used to communicate a particular message through a binary channel. The top trace represents the hexadecimal...
  • 19
  • 356
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx

... RehabilitationOpen AccessMethodology A novel method for neck coordination exercise a pilot study on persons with chronic non-specific neck painUlrik Röijezon*1,2,3, Martin Björklund1,3, Mikael Bergenheim1,4 ... I, Richardson C: A randomized controlled trial ofAdditional file 1 Neck coordination exercise. Movie of neck coordination exercise per-formed with the novel device on a medium fast surface.Click ... characteristicsSelf-rated pain was assessed as pain at the moment andmeasured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on which 0 mmcorresponds...
  • 10
  • 712
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

... JournalOpen AccessShort report A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoterLaurent Mailly1,2, Charlotte Boulade-Ladame1, Georges Orfanoudakis1 ... shuttle plasmid containing a promoter for the expression of the transgene. After selection of recombinants, the plasmid DNA of each clone has to betransferred into an other bacterial strain (i.e. ... recombinant adenoviral vectors. HumGene Ther 1999, 10(12):2013-2017.7. Mizuguchi H, Kay MA, Hayakawa T: In vitro ligation-based cloning of foreign DNAs into the E3 and E1 deletion regions for...
  • 4
  • 451
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... CATGATCAACTGCTCTGATTAC1741(+) GGGCTTCCCGTACTTTGTG2321(+) TGGATTTAGCTCCCTGAATGTYLCV primers for Q-PCR (176 bp amplicon)Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nMTy 2339- AACATTCAGGGAGCTAAATCCAG ... (A) in the multiple cloning site of the vector pGreen. (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A ... CTGAATGTTTGCATGGAAATGTGC 200 nMTy321- GGTCGCTTCGACATARTCACG 200 nMSequencing of TYLCV cloned sequencespGreen1589 (+) CACGACGTTGTAAAACGACGpG1825(-) CACAGGAAACAGCTATGACC579 (+) GATGTTACTCGTGGATCTGG1141...
  • 10
  • 396
  • 0
báo cáo hóa học:

báo cáo hóa học:" A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases" ppt

... A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases. Journal of TranslationalMedicine 2011 9:43.Submit ... combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant casesChong Xie1, Hyun J Kim2, Jonathan G Haw3, Anusha Kalbasi3, Brian K Gardner4, ... monoclonal Abagainst human PSA (Biocon, Inc. Rockville, MD) toquantify total PSA levels. sero MAP-based PSA quantifi-cation was compared with standard ELISA-based PSA assays (American Qualex) and...
  • 11
  • 434
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel cross-layer mesh router placement scheme for wireless mesh networks" pptx

... IEEEInternational Conference on Advanced Information Networking andApplications, 465–472 (2010)16. F Xhafa, C Sanchez, L Barolli, R Miho, An annealing approach to router nodes placement problem in wireless ... 802.16 - Standard for local and metropolitan area networks, Part 16: AirInterface for Broadband Wireless Access Systems (2004)35. H-Y Wei, S Ganguly, R Izmailov, ZJ Haas, Interference-aware IEEE ... maximum traffic demand of user i;rij: transmission rate between user i and MR j;Cmax: maximum link capacity of a local accessantenna;Rj: local coverage of MR j;Rmax: maximum local...
  • 14
  • 426
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "A novel code-based iterative PIC scheme for multirate CI/MC-CDMA communication" doc

... Open AccessA novel code-based iterative PIC scheme for multirate CI/MC-CDMA communicationMithun Mukherjee*and Preetam KumarAbstractThis paper introduces a novel code-based iterative parallel ... Code -PIC is com-parabletoSub-PICuptoasystemloadofabout1.5Nand for higher loads Code -PIC outperforms Sub -PIC. 8 ConclusionIn this paper, Code -PIC scheme is introduced for multi-rate CI/MC-CDMA ... [22]. For synchronous CI/MC-CDMAuplink,thresholdPIC(TPIC)andBlock- PIC [24] have been designed to provide better perfor-mance than conventional PIC scheme. Block -PIC signifi-cantly outperforms...
  • 12
  • 421
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel gas ionization sensor using Pd nanoparticle-capped ZnO" ppt

... Fu1,3*Abstract A novel gas ionization sensor using Pd nanoparticle-capped ZnO (Pd/ ZnO) nanorods as the anode is proposed.The Pd/ ZnO nanorod-based sensors, compared with the bare ZnO nanorod, show ... for gas sensor applications. I nthis study, we int roduce a physical gas sensor using pal-ladium (Pd) nanoparticle-capped ZnO (Pd/ ZnO) nanor-ods as the anode. The results show that the breakdownvoltage ... NANO EXPRESS Open Access A novel gas ionization sensor using Pd nanoparticle-capped ZnOHongjun Wang1, Changwei Zou2, Canxin Tian1, Lin Zhou1, Zesong Wang1and Dejun Fu1,3*AbstractA...
  • 4
  • 195
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx

... 24:1663-1677.doi:10.1186/1687-5281-2011-6Cite this article as: Tsai and Chou: A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras. EURASIP Journal on Image and Video Processing ... ChouAbstractThis article addresses the problem of low dynamic range image enhancement for commercial digital cameras. A novel simultaneous dynamic range compression and local contrast enhancement algorithm ... 2011:6http://jivp.eurasipjournals.com/content/2011/1/6Page 14 of 19RESEARCH Open Access A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video camerasChi-Yi Tsai* and Chien-Hsing ChouAbstractThis...
  • 19
  • 353
  • 0
báo cáo hóa học:

báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" pptx

... 24:1663-1677.doi:10.1186/1687-5281-2011-6Cite this article as: Tsai and Chou: A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras. EURASIP Journal on Image and Video Processing ... with a local contrast enhancement algorithm. For local contrast enhancement, histogram equalization (HE)-based con-trast enhancement algorithms, such as adaptive HE(AHE) [10] and contrast- limited ... 19RESEARCH Open Access A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video camerasChi-Yi Tsai* and Chien-Hsing ChouAbstractThis article addresses...
  • 19
  • 463
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel ULA-based geometry for improving AOA estimation" potx

... this article as: Shirvani-Moghaddam and Akbari: A novel ULA-based geometry for improving AOA estimation. EURASIP Journal on Advances inSignal Processing 2011 2011:39.Submit your manuscript to a ... PA is an appropriateand simple geometry for AOA estimation and can mod-ify the performance of the conventional ULA in AOA estimation. This structure may provide the ability of 3-D AOA estimation ... Shirvani-Moghaddam1*and Farida Akbari2AbstractDue to relatively simple implementation, Uniform Linear Array (ULA) is a popular geometry for array signalprocessing. Despite this advantage,...
  • 11
  • 521
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel mechanical cleavage method for synthesizing few-layer graphenes" ppt

... this article as: Jayasena and Subbiah: A novel mechanical cleavage method for synthesizing few-layer graphenes. Nanoscale Research Letters2011 6:95.Submit your manuscript to a journal and benefi ... under microwaves irradiation. Appl Catal, A 2009, 371(1-2):22-30.7. Subrahmanyam KS, Panchakarla LS, Govindaraj A, Rao CNR: Simple Method of Preparing Graphene Flakes by an Arc-Discharge Method. ... paper, is another laboratory-based method for graphene sample preparation. The scotch tape method is the popular method of mechanical cleavage [11] that has been explored for separation of graphene.Repeated...
  • 7
  • 344
  • 0
báo cáo hóa học:

báo cáo hóa học:" A novel voice activity detection based on phoneme recognition using statistical model" ppt

... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon. A novel voice activity detection based on phoneme ... qunzhong@sjtu.edu.cnEmail address:JZ: zhujie@sjtu.edu.cnEmail:∗Corresponding authorAbstractIn this article, a novel voice activity detection (VAD) approach based on phoneme recognition using GaussianMixture ... Sung, A statistical model -based voice activity detection. IEEE Signal Process. Lett.16(1), 1–3(1999)14. YD Cho, K Al-Naimi, A Kondoz, Improved voice activity detectionbased on a Smoothed statistical likelihood...
  • 28
  • 394
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Novel Self-aligned and Maskless Process for Formation of Highly Uniform Arrays of Nanoholes and Nanopillars" pot

... is anincreasing demand for rapid, parallel fabrication strategies for nanoholes and nanopillars. Some applications thatrequire repetitive uniform nanoholes and nanopillars overlarge area are ... NANO EXPRESS A Novel Self-aligned and Maskless Process for Formation of Highly Uniform Arrays of Nanoholes and NanopillarsWei Wu Æ Dibyendu Dey Æ Omer G. Memis ÆAlex Katsnelson Æ Hooman MohseniReceived: ... Micro- and nanospheres that have highly uniform sizes and could easily produce a hexagonally close packed(HCP) self-assembled monolayer have attracted wide-spread attention for forming large areas...
  • 5
  • 281
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM