Báo cáo hóa học: "IDEA1: A validated SystemC-based system-le

Báo cáo hóa học: "IDEA1: A validated SystemC-based system-level design and simulation environment for wireless sensor networks" pot

... 20 RESEARCH Open Access IDEA1: A validated SystemC-based system-level design and simulation environment for wireless sensor networks Wan Du * , Fabien Mieyeville, David Navarro and Ian O Connor Abstract This ... 2009) doi:10.1186/1687-1499-2011-143 Cite this article as: Du et al.: IDEA1: A validated SystemC-based system- level design and simulation environ...

Ngày tải lên : 20/06/2014, 22:20

20
408
0

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... levels have less pain crises [1] and longer life spans [2]. Th ere- fore pharmacolog ical agents that can elevate fetal hemoglobin have great potential as therapeutic agents. The DNA methy...

Ngày tải lên : 18/06/2014, 16:20

8
443
0

báo cáo hóa học:" Extensor-tendons reconstruction using autogenous palmaris longus tendon grafting for rheumatoid arthritis patients" pot

... and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript. References 1. Larsen A, Dale K, Eek M: Radiographic evaluation ... the met- acarpophalangeal and interphalangeal joints in a neutral position. Passive interphalangeal-joint exercises were ini- tiated 24–48 hours postoperatively and light acti...

Ngày tải lên : 20/06/2014, 01:20

5
306
0

Báo cáo hóa học: " Colistin: recent data on pharmacodynamics properties and clinical efficacy in critically ill patients" pot

... participated in advisory boards of Pfizer, Astellas, and Bayer and has received lecture honoraria from Merck, Pfizer, AstraZeneca, Astellas, Cipla, Novartis, and Glenmark. Received: 19 April 2011 Accepted: ... infections caused by gram-negative bacteria. Antimicrob Agents Chemother 2009, 53:3430-3436. 15. Daikos GL, Skiada A, Pavleas J, Vafiadi C, Salatas K, Tofas P, Tzanetou K, Markog...

Ngày tải lên : 21/06/2014, 01:20

6
329
0

Báo cáo hóa học: "Transmission electron microscopic observations of nanobubbles and their capture of impurities in wastewater" potx

... prototype plant manu- factured by Mayekawa MFG. Co., Ltd., Ibaraki, Japan, pure O 2 gas was aerated through the MNB ge nerator (NikuniCo.,Ltd.,Kanagawa,Japan,MBG20ND04Z- 1GB) for 5 min. After aeration, ... have thus also attracted much attention as a functional material in the biological area, such as acceleratin g metabolism in vege- tables [9], aerobic cultivation of yeast [10], and s...

Ngày tải lên : 21/06/2014, 04:20

9
327
0

báo cáo hóa học:" Research Article Ontology-Based Device Descriptions and Device Repository for Building Automation Devices Henrik Dibowski and Klaus Kabitzsch" potx

... types Parameter types Variable types Parameter types Standard proﬁles Standard variable types Standard parameter types Data types Hardware Manufacturers Functions LonMark standardizations Type deﬁnitionsType ... Output datapoints on the other hand are distinguished in active and inactive. Only active outputs provide values and are possible candidates for datapoint bindings. With that in...

Ngày tải lên : 21/06/2014, 11:20

17
426
0

báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx

... tremor Tool Parameter analyzed Clinical scales Clinical scores of disability Videos Clinical characterization of tremor Quantification of drawings Evaluation of tremor in 2 dimensions Surface and needle ... within the basal ganglia system, especially the pallidum and the subthalamic nucleus, but are mainly synchronized by cortical activity via the striatal inputs. There is an abnormal cou...

Ngày tải lên : 18/06/2014, 15:20

6
338
0

báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

... 68:36-42. 14. Tyagi A, Singh RP, Agarwal C, Siriwardana S, Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C pathway as a central mechanism for S phase arrest ... Villegas I: Resveratrol as an anti-inflammatory and anti-aging agent: mechanisms and clinical implications. Mol Nutr Food Res 2005, 49:405-430. 4. Palamara AT, Nencioni L, Aqui...

Ngày tải lên : 18/06/2014, 15:20

13
714
0

báo cáo hóa học:" HLA-A" doc

... kawaguch@sapmed.ac.jp; Toshihiko Torigoe - torigoe@sapmed.ac.jp; Akari Takahashi - atakahashi@sapporo.jst-plaza.jp; Masaki Murase - murasem@sapmed.ac.jp; Masanobu Kano - kanomasa@sapmed.ac.jp; Takuro ... Takuro Wada - twada@sapmed.ac.jp; Mitsunori Kaya - mkaya@sapmed.ac.jp; Satoshi Nagoya - nagoya@sapmed.ac.jp; Toshihiko Yamashita - tyamasit@sapmed.ac.jp; Noriyuki Sato - nsatou@sapmed.ac.j...

Ngày tải lên : 18/06/2014, 15:20

10
358
0

Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc

... vinblastine, dacarbazine, interleukin-2, and interferon alfa-2b with cisplatin, vinblastine, and dacarbazine alone in patients with metastatic malignant melanoma (E3695): a trial coordinated ... clinical trials. A paramount step along the way would be to foster arrangements that could allow more access to agents both for clinical and pre-clinical studies and more complete acc...

Ngày tải lên : 18/06/2014, 16:20

7
449
0