Báo cáo hóa học: " Mild hypoglycemia is strongly associated with increased intensive care unit length of stay" pdf
báo cáo hóa học: " Serum lipid profiles are associated with disability and MRI outcomes in multiple sclerosis" pptx
... 10:691-701.doi:10.1186/1742-2094-8-127Cite this article as: Weinstock-Guttman et al.: Serum lipid profiles are associated with disability and MRI outcomes in multip le sclerosis.Journal of Neuroinflammation 2011 8:127.Submit ... progres-sion. Increased total cholesterol w as associated with increases in the number of contrast-enhancing lesions onbrain MRI in clinically isolated syndrome patients follow-ing a first clinical ... of serum lipid prof ile variables (serum cholesterol,HDL, LDL and triglycerides) to clinical disability and braintissue integrity as measured with quantitative magneticresonance imaging (MRI) ...
- 7
- 612
- 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... CATGATCAACTGCTCTGATTAC1741(+) GGGCTTCCCGTACTTTGTG2321(+) TGGATTTAGCTCCCTGAATGTYLCV primers for Q-PCR (176 bp amplicon)Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nMTy 2339- AACATTCAGGGAGCTAAATCCAG ... (A) in the multiple cloning site of the vector pGreen. (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A ... CTGAATGTTTGCATGGAAATGTGC 200 nMTy321- GGTCGCTTCGACATARTCACG 200 nMSequencing of TYLCV cloned sequencespGreen1589 (+) CACGACGTTGTAAAACGACGpG1825(-) CACAGGAAACAGCTATGACC579 (+) GATGTTACTCGTGGATCTGG1141...
- 10
- 396
- 0
Báo cáo hóa học: " Mild hypoglycemia is strongly associated with increased intensive care unit length of stay" pdf
... those without hypoglycemia for the entire cohort of 6,240 patients. Patients with hypoglycemia were older, 1 Mild hypoglycemia is strongly associated with increased intensive care unit length ... (HTML) versions will be made available soon. Mild hypoglycemia is strongly associated with increased intensive care unit length of stayAnnals of Intensive Care 2011, 1:49 doi:10.1186/2110-5820-1-49James ... 72% of the patients with hypoglycemia in the NL cohort had an episode within the first 48 hours of ICU admission. Figure 5 displays the strong association between the number of episodes of hypoglycemia...
- 29
- 390
- 0
báo cáo hóa học:" Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema" doc
... ProcessingVolume 2009, Article ID 203790, 13 pagesdoi:10.1155/2009/203790 Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold EdemaConstantine ... 0.40.45 0.5PFAWithoutrejectoption With reject option Figure 6: Zoom in the experimental ROC curves of the linear classifier applied to vocal fold edema detection in women without reject option (dashed ... 0.0172 and PD= 0.994709, when the reject option is enabled. The superiority of the linear classifier with reject option is demonstrated in Figure 5, where the convex hull of the ROC curves with reject...
- 13
- 365
- 0
Báo cáo hóa học: " Research Article Computational Issues Associated with Automatic Calculation of Acute Myocardial Infarction Scores" doc
... Signal ProcessingVolume 2008, Article ID 670529, 10 pagesdoi:10.1155/2008/670529 Research Article Computational Issues Associated with Automatic Calculation of Acute Myocardial Infarc tion ScoresJ. ... during acute myocardial infarction, ” The Ameri-can Journal of Cardiology, vol. 54, no. 3, pp. 249–255, 1984.[8] P. Schweitzer, “The electrocardiographic diagnosis of acute myocardial infarction ... “Extent of early ST segment elevationresolution: a strong predictor of outcome in patients with acute myocardial infarction and a sensitive measure to com-pare thrombolytic regimens. A substudy of...
- 10
- 362
- 0
Báo cáo hóa học: " Research Article Functional Inequalities Associated with Jordan-von Neumann-Type Additive Functional " potx
... CorporationJournal of Inequalities and ApplicationsVolume 2007, Article ID 41820, 13 pagesdoi:10.1155/2007/41820 Research Article Functional Inequalities Associated with Jordan-von Neumann-Type Additive Functional ... functional inequality associated w ith a 3-variableCauchy additive functional equationWe prove the generalized Hyers-Ulam stability of a functional inequality associated with a Jordan-von Neumann-type ... functional inequality associated w ith a 3-variableJensen additive functional equationWe prove the generalized Hyers-Ulam stability of a functional inequality associated with a Jordan-von Neumann-type...
- 13
- 212
- 0
Báo cáo khoa hoc:" Sporadic ALS is not associated with VAPB gene mutations in Southern Italy" ppt
... number not for citation purposes)Journal of Negative Results in BioMedicineOpen AccessBrief report Sporadic ALS is not associated with VAPB gene mutations in Southern ItalyFrancesca Luisa ... Alsin gene located at 2q33 [4]. To date over100 different missense mutations in the Sod1 gene [5] andup to eight described mutations in the Alsin gene havebeen reported [6].By contrast, sporadic ... finding by Nishimura et al.[16] of a missense muta-tion in the VAMP/synaptobrevin -associated membraneprotein B (VAPB) gene in autosomal dominant motoneu-ron diseases (ALS8 ), prompted us to investigate...
- 3
- 308
- 0
Báo cáo y học: " Predisposing factors for delirium in the surgical intensive care unit" pps
... deterioration in the homeostasis and physical status of the patient. The objective of our study was to investigate the predisposing factors for delirium in a surgical intensive care unit (ICU) setting.Method ... emergencyroom. Gen Hosp Psychiatry 1995, 17:371-379.30. Geary SM: Intensive care unit psychosis revisited: Under-standing and managing delirium in the critical care setting.Crit Care Nurs ... reduce the inci-dence of delirium in the patients who are at high risk by care- fully ordering and monitoring the dosages of drugs, andwatching for signs of cardiac ischemia during the periopera-tive...
- 6
- 253
- 0
Báo cáo khoa học: "Remifentanil for analgesia-based sedation in the intensive care unit" pdf
... to a strict and goal-orientated algorithm for defining, assessing and reassessing analgesia and sedation is more important than finding the magic bullet for a particularsubstance [7].However, ... protocols for sedatives and analgesics is effective in terms of improvingclinical outcomes, mainly by avoiding unnecessaryoverdosing, with prolonged mechanical ventilation and stay in the ICU ... toachieve the targeted sedation level of 4 on the Sedation Agitation Scale [5] (reflecting a calm and easilyarousable state, in which the patient is able to followcommands) in almost 90% of the duration...
- 3
- 244
- 0
Báo cáo khoa học: ":Clinically important deep vein thrombosis in the intensive care unit: a survey of intensivists" pot
... addition, a definition of clinically important DVT could be used in future clinicalresearch. Therefore, as a first step toward defining a 'clinically important DVT', we surveyed critical care ... the lack of such data, the con-cept of a clinically important DVT in the critically ill is important because such an assessment may be used to determinewhether a DVT should be treated; in addition, ... MoreMuch MoreTable 1Patient factors affecting the clinical importance of deep venous thrombosis in intensive care unit patientsPatient factor Mean (SD)ratingClinical suspicion of pulmonary embolism...
- 8
- 269
- 0
Báo cáo y học: "Clinical review: Acid–base abnormalities in the intensive care unit" doc
... utility identified in some studiesthat is conspicuously lacking in others? The answer may befound in the timing. Much like base excess, the value of the SIG may be related to the time of assay. ... for other injuries in isolation orcombination. The interpretation of SBE must thereforeincorporate the injury complex into decision-making, perhapslimiting its utility. A recent study of salvageable ... regarding the likelihood of survival. The Stewartphysico-chemical approach to acid–base analysis readilylends itself to these determinations by precisely evaluating the independent determinants...
- 6
- 337
- 0
Báo cáo y học: " A stronger approach to weakness in the intensive care unit" doc
... distally in the Figure 1 A flow chart giving an approach to generalized weakness and/or ventilatory failure in the intensive care unit. CK, creatine kinase; CSF,cerebrospinal fluid; GBS, Guillain–Barré ... andtheir relative contributions to the weakness may varyconsiderably when this occurs. Elevated serum creatinekinase may help to identify CIM, but the peak may be missed in the membranopathy/necrotizing ... necessary if the needle biopsies are inadequate.Being aware of the incidence and signs of ICU-acquired weakness with ventilatory failure and having an approach to such disorders will prove valuable...
- 3
- 298
- 0
Báo cáo khoa học: "Bench-to-bedside review: Dealing with increased intensive care unit staff turnover: a leadership challenge" pdf
... = intensive care unit. Critical Care October 2005 Vol 9 No 5 Laporta et al.AbstractCritical care leaders frequently must face challenging situationsrequiring specific leadership and management ... HCS Staffing levels. Intensive Care Society Standards Committee National AHP andHCS Critical Care Advisory Group, Critical Care Pro-gramme Modernisation Agency [http://www.ics.ac.uk/downloads/AHPHCSCriticalCareStaffing .pdf] 5. ... of health care assistants [3]Skill mix of intensive care unit team membersStaffing levelsOther duties (clinical, administrative, academic) Staff supportb Leadership (nursing, medical)Team...
- 5
- 257
- 0
Báo cáo khoa học: "Elevated troponin and myocardial infarction in the intensive care unit: a prospective study" potx
... classified as having MI or noMI during their ICU stay [2].Statistical analysisWe report continuous data as mean and standard deviation ormedian and interquartile range (IQR), as appropriate. ... evidence of myocardial ischemia. An elevated troponin alone cannotestablish a diagnosis of myocardial infarction (MI), yet the optimal methods for diagnosing MI in the intensive care unit(ICU) are ... communication, and anelevated troponin can be discovered following the peak level and after an event has occurred. In addition, troponin canremain elevated for up to 14 days [1] and in practice is notalways...
- 9
- 336
- 0
Báo cáo khoa học: "Changes in appetite related gut hormones in intensive care unit patients: a pilot cohort study" doc
... purposes)Vol 10 No 1ResearchChanges in appetite related gut hormones in intensive care unit patients: a pilot cohort studyMohsen Nematy1, Jacqui E O'Flynn2, Liesl Wandrag2, Audrey E Brynes3, ... preparation. All authors read andapproved the final manuscript.AcknowledgementsWe thank ICU staff at both Hammersmith and Charing Cross hospitals (CXH) for facilitating recruitment and taking ... andinterpretation of ghrelin and PYY results. MN was responsiblefor taking blood, data collections and analysis, doing radioim-munoassays, column chromatography assays, statistical anal-ysis and manuscript...
- 9
- 226
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ