Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
báo cáo hóa học:" Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson''''s disease" doc
... AccessResearch Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson's ... pro-tein bands. The protein DAT could not be detected in RPE cells. (B) The cDNA of DDC but not DAT was detected by PCR from the total cDNA of RPE cells. Table 2: DA and HVA in RPE cells extract ... [9]. RPE cells are melanin containing cells that constitute amonolayer between the neural retina and the choroid. In RPE cells, tyrosine is catalyzed by tyrosinase to L-dopathat is polymerized to...
- 9
- 449
- 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... hepatic cancer, colon cancer and lung cancer. Immunostaining of prostate cancer tissue with antibodies against AMACR and PSAFigure 2Immunostaining of prostate cancer tissue with antibodies against ... mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) . In contrast, the AMACR mRNA levelwas elevated in all ... AbstractAlpha-methylacyl-CoA racemase (AMACR) is an enzyme playing an important role in the beta-oxidation of branched-chain fatty acids and fatty acid derivatives. High expression levels of...
- 11
- 531
- 0
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
... conception, design, and acquisition of data, analysis and interpretation of data, writing and approval of the manuscript.Competing interestsThe author declares that they have no competing interests.Received: ... be used instead of VAD.Finally, DAPK methylation and oligoclonal reconstitu-tion as potential adverse and favorable risk factors in mye-loma warrants further validation with larger number of patients ... degree of response in multiple myeloma. Br J Haematol 2008, 143.doi:10.1186/1479-5876-8-124Cite this article as: Chim: Updated survivals and prognostic factor analysis in myeloma treated by a staged...
- 7
- 489
- 0
Báo cáo hóa học: " Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial" potx
... RESEARCH Open Access Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trialHsiu-Chen Huang1,2, ... reduce the forward sliding and sacral peak pressure of stroke patients with flaccid hemiplegia. The back displacement of able-bodiedsubjects when using both conventional and V-shape seats in reclining ... sacral pressure of stroke patients with flaccid hemiplegia,who are subject to m ore forward sliding and sacral pressure in reclining wheelchairs than able-bodiedelders. V-shaped seats in reclining...
- 8
- 375
- 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S,Yambe T, Nitta S: Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlationbetween pulse transmission ... of 9(page number not for citation purposes)Journal of NeuroEngineering and RehabilitationOpen AccessResearch Could sound be used as a strategy for reducing symptoms of perceived motion ... between the sympathetic and parasympatheticnervous system that normally occurs before the subject isaware of any change in wellbeing can be observed. Thereason for using both subjective ratings...
- 9
- 609
- 0
báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx
... detection of the level of dopaminergic neuronal terminals, and fornormalization of the loading protein. The signal was vis-ualized by enhanced chemiluminescence according to the instructions of the ... activation of microglia in the rat 6-hydroxy dopamine-induced PD model [32]. We show for the first time a direct correlationbetween COX-2 and microglia activation in the mouse MPTP model. Using the ... deficiency mediates effects involved in the neuroprotection of the SNpc dopaminergic neurons in MPTP- induced mouse parkinsonism. This means that the differences in neuronaldegeneration or microglial activation...
- 16
- 468
- 0
báo cáo hóa học: " Aspirin-triggered lipoxin A4 attenuates LPSinduced pro-inflammatory responses by inhibiting activation of NF-B and MAPKs in BV-2 microglial cells" pptx
... Wang et al.: Aspirin-triggered lipoxin A4 attenuates LPS-induced pro-inflammatory responses by inhibiting activation of NF-B and MAPKs in BV-2 microglial cells. Journal of Neuroinflammation2011 ... or by potentiating glutamaterelease, thereby enhancing excitotoxi city [41]. IL-1b and TNF-a also drive self-propagating cycles of microglial activation and neuroinflammation by inducing activation of ... production and mRNA and pro-tein expression of iNOS in dose-dependent mannerswithout significant cytotoxicity. This indicates that inhi-bition of NO production by ATL is a result of inhibition of iNOS...
- 12
- 414
- 0
báo cáo hóa học:" RNAi dependent epigenetic marks on a geminivirus promoter" doc
... amplifica-tion the left arm (KpnI F: GGTACCAATCTCAACTAGA-GACACTCTTGA) and (ClaI R:ATCGATGCACAAATATTTAATTGCCAG), and the rightarm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC)and (BamHI R: GGATCCAATGAGTTGATCTCTGTGA-GAACT). ... analysed by electrophoresis on a 2%agarose gel. The primer pairs used were ACMV DNA A F:CTCAACTAGAGACACTCTTGA and R: CACAAATATT-TAATTGCCAG, Tnt-retroposon (GenBank: X13777) F:CATTGGTTCTAAAGGATGTGCGGC ... orSmall RNA-directed DNA and histone methylationFigure 2Small RNA-directed DNA and histone methylation. (A) Schematic representation of Sau96 I restriction sites in ACMV DNA A promoter region and...
- 4
- 244
- 0
Báo cáo hóa học: " Gold colloidal nanoparticle electrodeposition on a silicon surface in a uniform electric field" pdf
... solution onto a planar silicon surface. Theadsorption of nanoparticles onto silicon is described andthe surface density obtained is investi gated in function ofthe usual experimental param eters: ... distribution was obtained and adsorptionwas irreversible. The density o f a gold nanoparticle assembly was investigated and analyzed in relation to sev-eral parameters such as voltage, the electric ... is analyzed in relation toseveral parameters: applied voltage, electric field, exchanged charge. Electrical, chemical, andelectrohydrodynamical parameters are taken into account in describing...
- 8
- 320
- 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
... NANO REVIEW Open Access Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitonsArtur Medvid*, Pavels ... Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons. Nanoscale Research Letters2011 6:582.Submit your manuscript ... Pavels Onufrijevs and Alexander MychkoAbstract On the basis of the analysis of experimental results, a two-stage mechanism of nanocones formation on theirradiated surface of semiconductors by Nd:YAG...
- 6
- 489
- 0
Báo cáo hóa học: "An antibacterial coating based on a polymer/solgel hybrid matrix loaded with silver nanoparticles" pdf
... Ruiz Zamarreño, Francisco Javier Arregui andIgnacio Raúl MatíasAbstractIn this work a novel antibacterial surface composed of an organic-inorganic hybrid matrix of tetraorthosilicate and a polyelectrolyte ... NANO EXPRESS Open AccessAn antibacterial coating based on a polymer/sol-gel hybrid matrix loaded with silver nanoparticlesPedro José Rivero*, Aitor Urrutia, Javier Goicoechea, Carlos ... high antibacterial activity. Moreover, a surface can obtain contact bacteria-killing capacitythrough chemical modification with tethered bactericidalfunctionalities such as quaternary amine...
- 7
- 460
- 0
Báo cáo hóa học: " Organic electrochemical transistors based on a dielectrophoretically aligned nanowire array" pptx
... transistors based on a dielectrophoretically aligned nanowire arrayWooSeok Choi1, Taechang An1and Geunbae Lim1,2*AbstractIn this study, we synthesized an organic electrochemical transistor ... a carbonnanotube-Nafion (CNT-Nafion) suspension. Dielectrophoretically aligned nanowires formed a one-dimensionalsubmicron bundle betwe en triangular electrodes. The CNT-Nafion composite nanowire ... studies.Nanotechnology 2009, 20:255102.doi:10.1186/1556-276X-6-339Cite this article as: Choi et al.: Organic electrochemical transistors based on a dielectrophoretically aligned nanowire array. Nanoscale...
- 5
- 284
- 0
Báo cáo hóa học: " Properties of silicon dioxide layers with embedded metal nanocrystals produced by oxidation of Si:Me mixture" doc
... 6:148http://www.nanoscalereslett.com/content/6/1/148Page 3 of 6NANO EXPRESS Open Access Properties of silicon dioxide layers with embedded metal nanocrystals produced by oxidation of Si:Me mixtureAndrei Novikau1*, ... 86:013107.doi:10.1186/1556-276X-6-148Cite this article as: Novikau et al.: Properties of silicon dioxide layers with embedded metal nanocrystals produced by oxidation of Si:Me mixture. Nanoscale Research Letters 2011 6:148.Submit ... Zenkevich2AbstractA two-dimensional layers of metal (Me) nanocrystals embedded in SiO2were produced by pulsed laser deposition of uniformly mixed Si:Me film followed by its furnace oxidation and rapid thermal...
- 6
- 516
- 0
Báo cáo hóa học: " Properties of gold nanostructures sputtered on glass" potx
... the last one plays arole only in thin layers, and it is responsible for thereduction of the electric conductivity of thin layers [8].Mathematical formula for the calculation of relaxationtimes ... nanoparticledecreases [5-7]. Properties of metal layers are affectedby electron scattering on phonons, on imperfections,and at layer boundaries. While the first two types of scattering occur also ... thatoptical absorption of island films of gold is a function of island density [35]. The absorption band resulting frombounded plasma resonance in the particles is shifted tolonger wavelengths...
- 9
- 333
- 0
Báo cáo hóa học: " Properties and applications of quantum dot heterostructures grown by molecular beam epitaxy" pot
... REVIEW Properties and applications of quantum dot heterostructures grown by molecular beam epitaxyM. HeniniPublished online: 26 July 2006Ó to the authors 2006Figure 14 shows plots of the ... Schematic diagram of the density of states (DOS) in theconduction band (CB) and valence band (VB) for a (a) doubleheterostructure, (b) quantum well, (c) quantum wire, and (d) quantum box laserNanoscale ... grow InAs islands on GaAs and it has been shown that the size fluctuation of dots isrelatively small (£10%) and the small dots and sur-rounding host matrix are dislocation-free and strainedcoherently...
- 14
- 292
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quotbài báo cáo môn học hóa vô cơ nâng caohoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM