Báo cáo toán học: " Population level risk assessment: practical considerations for evaluation of population models from a risk assessor''''''''s perspective" docx
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-ments containing a complete x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, ... kit and the ABI 3100 DNA sequencer(Applied Biosystems, Foster City, CA, USA).Expression and purification of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense ... Total genomic DNA was isolated from 0.1 g frozenleaves by the Isoplant DNA extraction Kit (Takara Bio Inc.,Shiga, Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and...
- 8
- 484
- 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... boundaries as hiddenvariables and include probabilities for let-ter transitions within segments. The ad-vantage of this model family is that it canlearn from small datasets and easily gen-eralises ... probabilistically combine ParaMor(Monson, 2008) and Morfessor (Creutz, 2006).They used a natural language tagger which wastrained on the output of ParaMor and Morfes-sor. The goal was to mimic each algorithm ... tjibeing a tran-sition from a certain lj,i−1∈ A Bto lji. The ad-vantage of the model is that instead of evaluatingan exponential number of possible segmentations(2m), the best segmentation...
- 9
- 557
- 0
Tài liệu Báo cáo khoa học: "Keyword Extraction using Term-Domain Interdependence for Dictation of Radio News" ppt
... because of many noisy keywords. In our method, newspaper articles and units of radio news are classified into many domains. At each domain, a feature vector is calculated by an encyclopedia ... noun at each domain. We call the feature vector FeaVe. Each element of FeaVe is a X 2 value (Suzuki et al., 1997). Then, nouns are extracted from newspaper ar- ticles by a morphological analysis ... analysis system (Mat- sumoto et al., 1997), and frequency of each noun are counted. Next, similarity between FeaVe of each domain and each newspaper article are cal- culated by using formula...
- 5
- 414
- 1
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot
... a manner analogous to whathas been shown for APP [50] and to what has beenpresented here for APLP1. As BACE1 did not alter thelevels of APP, APLP1 and APLP2 mRNA, it wouldappear that BACE1 ... independent of genetic background (Fig. S5), and indicate that BACE1is responsible for the generation of at least 20% of APLP2s.BACE1 manipulation alters the quantity and form of APP, APLP1 and APLP2 ... truncated a- cleaved form of amy-loid precursor protein, APPsa) [17,18]. a- Secretasecleavage is mediated by at least three enzymes, all of which are members of the ADAM (a disintegrin andmetalloprotease)...
- 16
- 549
- 0
báo cáo hóa học: "Using hierarchical clustering methods to classify motor activities of COPD patients from wearable sensor data" pdf
... suitedto small data sets. Each level of merging was trained andtested independently with a balanced set of data; i.e. a data set sampled equally from each class. 75% of samplesin the data set were ... 6 ambulatory tasks: walkingon a treadmill, level walking in a hallway, ascending/descending stairs, and ascending/descending a ramp.Ambulatory Task ClassificationResults for LDA-based classification ... an important area of research in wearable systems. Monitoring the health status of individuals undergoing cardiopulmonary rehabilita-tion is indeed an important clinical application of weara-ble...
- 14
- 404
- 0
báo cáo hóa học:" The calcar screw in angular stable plate fixation of proximal humeral fractures - a case study" potx
... 8. Duda G, Epari D, Babst R, Lambert S, Matthys R, NP S: Mechanical evaluation of a new minimally invasive device for stabilization of proximal humeral fractures in elderly patients: a cadaver ... JM, Pajarinen J, Savolainen V: Internal fixation of proximalhumeral fractures with a locking compression plate: a retrospective evaluation of 72 patients followed for a minimum of 1 year. Acta ... of the humeral head with an unrounding of the articularsurface.Statistical AnalysisStatistical analysis o f nominal data was done using 2-sided Fisher’ s Exact Tests, and metric data was pro-cessed...
- 6
- 364
- 0
Tài liệu Báo cáo khoa học: "Reading Level Assessment Using Support Vector Machines and Statistical Language Models" pdf
... are inadequate dueto their reliance on vocabulary lists and/or a superfi-cial representation of syntax. Our approach uses n-gram language models as a low-cost automatic ap-proximation of both ... a standard statistical parser (Charniak, 2000) toprovide syntactic analysis.In practice, a teacher is likely to be looking for texts at a particular level rather than classifying a group of ... proficiency is a fundamen-tal component of language competency.However, finding topical texts at an appro-priate reading level for foreign and sec-ond language learners is a challenge for teachers....
- 8
- 446
- 0
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2. Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) ... Tsuda H, Hirasawa A, Miura M, Sakamoto M, Hirohashi S, Inazawa J. Expression of cIAP1, a target for 11q22 amplification, correlates with resistance of cervical cancers to radiotherapy. Cancer ... such as caspase-3, caspase-6, and caspase-7 are executioner caspases that remain dormant until the initiator caspases activate them by proteolysis [8]. The activated executioner caspases cleave...
- 6
- 514
- 0
Tài liệu Báo cáo khoa học: "Two-Level, Many-Paths Generation" docx
... to load non-traditional duties onto a generator, such as word sense disambiguation for machine translation. For example, bei in Japanese may mean either American or rice, and sha may mean shrine ... vh@cs.columbia.edu Abstract Large-scale natural language generation re- quires the integration of vast mounts of knowledge: lexical, grammatical, and concep- tual. A robust generator must be able ... infor- mation can be extracted automatically, it has to be manually reformulated into the generator's represen- tational framework before it can be used as an addi- tional constraint during...
- 9
- 425
- 0
Báo cáo khoa học: "Text-level Discourse Parsing with Rich Linguistic Features" pdf
... individual instances rather thanindividual relation classes are not applicable.ased evaluation metrics in this task. Similar to Struc-ture classification, the accuracy on the training data(TAcc)4is ... experiments, all classi-fications are conducted and evaluated on the basis of individual instances.Each instance is of the form (SL, SR), which is a pair of adjacent text spans SL(left span) and ... rhetorical parsing of natu-ral language texts. In Proceedings of the 35th AnnualMeeting of the Association for Computational Linguis-tics, pages 96–103.Rashmi Prasad, Nikhil Dinesh, Alan Lee,...
- 9
- 340
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ